View | Download this marker

Marker details for CAC-C028

Crop Name HAZELNUT
Site National Clonal Germplasm Repository
Repeat Motif (GAA)10
Primers F: 5'CTACCCCATCGCTTGACAC3' R: 5'GGAGACTTGTTTGCCACAGA3'
Assay Conditions DNA was extracted from fresh hazelnut leaves according to Lunde et al. (2000). Forward primers for the 21 SSRs were fluorescently labeled with FAM, HEX or NED. Polymerase chain reactions (PCRs) were performed in a total volume of 10 �l. The reaction mixture contained 1X Biolase NH4 reaction buffer, 2 mM MgCl2, 200 �M each of dATP, dCTP, dGTP, and dTTP, 0.3 �M each of forward and reverse primers, 0.25 units of Biolase DNA polymerase (Bioline Inc., Randolph, MA), and 2.5 ng of template DNA. The PCR program consisted of 35 cycles of a 40 s denaturation step at 94 �C, a 40 s annealing step at the optimum annealing temperature, and a 40 s extension step at 72 �C. There was a final 30 min extension step at 72 �C to maximize non-templated adenosine addition to the 5' ends. PCRs were carried out in Perkin-Elmer model 9700 thermocyclers (Applied Biosystems, Foster City, CA). Amplification and approximate fragment sizes were confirmed by agarose (3%) gel electrophoresis. Amplified PCR products were diluted multiplexed and separated on an ABI 3100 capillary electrophoresis instrument at the Central Services Laboratory (CSL) of the Center for Genome Research and Biocomputing (CGRB) at OSU. DNA fragment sizes were determined using GeneScan and Genotyper software.
Range Products 125-146
Genbank Number DQ151606
Map location 10
Polymorphic Type MICROSATELLITE
Comment SSR-CAC-C028 was obtained from microsatellite enrichment for the AAG motif of genomic library C of hazelnut (Genetic Identification Services, Chatsworth, California); Linkage Group: 10R

Citation(s)
  • Gökirmak, T., S. A. Mehlenbacher, & N. V. Bassil. 2009. Characterization of European hazelnut (Corylus avellana) cultivars using SSR markers. Genet. Resources Crop Evol. 46:147-172. DOI: 10.1007/s10722-008-9352-8. Note: Corvallis
  • Gökirmak, T., S. A. Mehlenbacher, & N. V. Bassil. 2009. Characterization of European hazelnut (Corylus avellana) cultivars using SSR markers. Genet. Resources Crop Evol. 46:147-172. DOI: 10.1007/s10722-008-9352-8. Note: Parlier
  • Study of: CORYLUS.CORVALLIS.GOKIRMAK.GRCE.2009. Acta Hort.

Assay details for evaluation CULTIVATED.HAZELNUT.SSR.2005
Evaluation Method
DNA Extraction

DNA was extracted according to Lunde et al. (2000) with minor modifications: RNA was removed by incubation with RNase A (Sigma, St. Louis, MO) at 37 C for one hour followed by extraction with phenol: chloroform: isoamyl alcohol (25:24:1). The DNA concentrations were determined spectrophotometrically and adjusted to 5 ng/ul.

PCR Protocol

PCR reactions were performed in 10 mL volume containing 1X reaction buffer, 2 mM MgCl2, 0.2 mM dNTPs, 0.3 uM of each primer, 0.25 units of Biolase Taq DNA polymerase (Bioline Inc.), and 2.5 ng genomic DNA.

After initial denaturation at 94 C for 3 minutes, DNA was amplified for 35 cycles in Perkin-Elmer model 9700 thermocyclers (PE Applied Biosystems, Foster City, CA) programmed for a 40 s denaturation step at 94 C, a 40 s at optimum annealing temperature, and a 40 s extension step at 72 C. A final extension step of 72 C for 30 minutes followed.

View a table of the SSR data as an Excel Spreadsheet.


Assay Method
DNA was extracted according to Lunde et al. (2000) with minor modifications: RNA was removed by incubation with RNase A (Sigma, St. Louis, MO) at 37 C for one hour followed by extraction with phenol: chloroform: isoamyl alcohol (25:24:1). The DNA concentrations were determined spectrophotometrically and adjusted to 5 ng/ul. PCR reactions were performed in 10 �L volume containing 1X reaction buffer, 2 mM MgCl2, 0.2 mM dNTPs, 0.3 �M of each primer, 0.25 units of Biolase Taq DNA polymerase (Bioline Inc.), and 2.5 ng genomic DNA. After initial denaturation at 94 C for 3 min, DNA was amplified for 35 cycles in Perkin-Elmer model 9700 thermocyclers (PE Applied Biosystems, Foster City, CA) programmed for a 40 s denaturation step at 94 C, a 40 s at optimum annealing temperature of 60 C, and a 40 s extension step at 72 C. A final extension step of 72 C for 30 min followed. Separation: ABI3100 Capillary Electrophoresis.

Number of Observed Alleles
2

Size of Alleles
131-147


Assay details for evaluation CORYLUS.CORVALLIS.GOKIRMAK.GRCE.2009
Evaluation Method
The European hazelnut, Corylus avellana L., is the species of commerce and has been used as a food source by humans since prehistoric times. The objective of this study was to use 21 SSR loci to evaluate genetic diversity in 270 accessions of European hazelnut representing a wide geographic range from the USDA-ARS NCGR National collection and from the OSU hazelnut breeding collection. We also wanted to validate suspected duplicates, and investigate the parentage of some accessions. Of the 270 accessions, 198 had unique fingerprints while 72 were duplicates, as suspected based on identical morphology and incompatibility alleles. SSR alleles indicate the parentage of 31 accessions. The identification of duplicate and mislabeled accessions will improve management of the hazelnut germplasm collection. The results of this study were published in Genetic Resources and Crop Evolution 56(2): 147-172.

Assay Method
DNA was extracted from fresh hazelnut leaves according to Lunde et al. (2000). Forward primers for the 21 SSRs were fluorescently labeled with FAM, HEX or NED. Polymerase chain reactions (PCRs) were performed in a total volume of 10 �l. The reaction mixture contained 1X Biolase NH4 reaction buffer, 2 mM MgCl2, 200 �M each of dATP, dCTP, dGTP, and dTTP, 0.3 �M each of forward and reverse primers, 0.25 units of Biolase DNA polymerase (Bioline Inc., Randolph, MA), and 2.5 ng of template DNA. The PCR program consisted of 35 cycles of a 40 s denaturation step at 94 �C, a 40 s annealing step at the optimum annealing temperature, and a 40 s extension step at 72 �C. There was a final 30 min extension step at 72 �C to maximize non-templated adenosine addition to the 5' ends. PCRs were carried out in Perkin-Elmer model 9700 thermocyclers (Applied Biosystems, Foster City, CA). Amplification and approximate fragment sizes were confirmed by agarose (3%) gel electrophoresis. Amplified PCR products were diluted multiplexed and separated on an ABI 3100 capillary electrophoresis instrument at the Central Services Laboratory (CSL) of the Center for Genome Research and Biocomputing (CGRB) at OSU.

Scoring Method
DNA fragment sizes were determined using GeneScan and Genotyper software.

Number of Observed Alleles
6

Size of Alleles
131-147


Assay details for evaluation CORYLUS.CORVALLIS.BASSIL.ACTA.2009
Evaluation Method
The US Department of Agriculture (USDA), Agricultural Research Service maintains a genebank representing world hazelnut (Corylus L.) diversity. More than 670 clones are preserved as self-rooted trees in a two-hectare field planting in Corvallis, Oregon, with a single tree per accession. In 1996 and 1997, prior to the spread of eastern filbert blight caused by Anisogramma anomala to within 75 kilometers of Corvallis, a backup collection was established in Parlier, California. A core collection of 184 genotypes representing the wide taxonomic, geographic and phenotypic diversity of Corylus was targeted for this second planting. Two trees of each `core? genotype were grafted onto seedling rootstocks over a period of five years and an orchard was established in Parlier. The grafted trees in Parlier are at risk of identity problems due to suckers arising from below the graft union. In May 2007, young leaves were collected from 29 Parlier trees that exhibited uncharacteristic morphological phenotypes. A set of 12 simple sequence repeat (SSR) markers was used to fingerprint trees in the backup collection, and the results were compared to the fingerprints of the same accessions in the Corvallis collection. Based on the results, misidentified accessions were eliminated and the fingerprinting set will be refined further. The results of this study were presented at the VIIth ISHS International Congress on Hazelnut, in Viterbo, Italy and published in Acta Horticulturae 845: 95-102.

Assay Method
DNA was extracted from young, actively growing hazelnut leaves using a Puregene kit (Gentra Systems, Inc., Minneapolis, Minnesota) and a modified protocol developed in our laboratory for which details are available from the senior author. PCR reactions were carried out for each primer pair in an Eppendorf Gradient thermocycler (Eppendorf, Westbury, NY) or an MJ Research (Watertown, Mass.) Tetrad thermocycler. The forward primers were fluorescently labeled with D2, D3 or D4 WellRED dyes obtained from Sigma-Aldrich Inc. (Saint Louis, MO). The 15 ?l reaction volume contained 1X Biolase buffer, 3 mM MgCl2, 300 ?M each of dATP, dCTP, dGTP, and dTTP, 0.45 ?M each of forward and reverse primers, 0.375 units of Biolase Taq DNA polymerase (Bioline Inc., Randolph, MA), and 4 ng of template DNA. The PCR program consisted of 35 cycles of 94?C for 40 s, optimum Ta for 40 s and 72?C for 40 s. A final extension at 72?C for 30 min was used to maximize non-templated adenosine addition to the 5? ends. Once amplification was confirmed by 3% agarose gel electrophoresis, a small amount of PCR product (0.25 ?l for D4-; 0.5 ?l for D3-; and 1 ?l for D2-labeled fragments) was pooled for each multiplex and the mixture was separated by capillary electrophoresis using a Beckman CEQ 8000 genetic analyzer (Beckman Coulter, Inc., Fullerton, CA).

Scoring Method
Allele sizing and visualization was performed using the fragment analysis module of the Beckman CEQ 8000 software. Alleles were scored by fitting the peaks into bins of less than 1 nucleotide.

Number of Observed Alleles
4

Size of Alleles
138-150


Assay details for evaluation CORYLUS.CORVALLIS.BASSIL.GRCE.2011
Evaluation Method
In this study, 23 SSRs from a tri-nucleotide enriched genomic library of hazelnut were screened for amplification and polymorphism in 114 representative accessions from 11 Corylus species and 44 hybrids. Fourteen SSRs amplified a single locus and were polymorphic in all species. This study identifies SSRs that can be used for each of these species. The 14 SSRs were used to fingerprint each accession. Diversity estimates were calculated using 8 easy-to-score SSRs. Nuclear SSRs were also compared to universal chloroplast SSRs and the results of this study were submitted to Genetic Resources and Crop Evolution.

Assay Method
DNA was extracted from actively growing leaves collected from the NCGR field in the spring using a modified PUREGENE� kit (Gentra Systems Inc., MN) protocol. Out of 23 SSR primer pairs developed from trinucleotide-enriched genomic library, 15 SSRs amplified in each of the 11 species evaluated in this study and were further characterized. PCR reactions were carried out separately for each primer pair and up to three PCR products (one per SSR primer set) were pooled in a multiplex and separated using capillary electrophoresis. PCR reactions were carried out in 10 ?L volumes using fluorescently labeled forward primers (FAM, HEX, or NED) and unlabeled reverse primers. PCR reactions contained per 10 ?L total volume 1X reaction buffer, 2 mM MgCl2, 0.2 mM dNTPs, 0.3 ?M of each primer, 0.25 units of Biolase Taq DNA polymerase, and 2.5 ng genomic DNA. The PCR protocol consisted of one cycle of initial denaturation at 94 �C for 3 min, followed by 35 cycles of denaturation at 93 �C for 40 s, annealing at optimum Ta for 40 s, and extension at 72 �C for 40 s. A final extension cycle at 72 �C for 30 min followed. DNA was amplified in an Eppendorf Gradient thermocycler or an MJ Research Tetrad thermocycler. The success of the PCR reaction was verified by 2% agarose gel electrophoresis prior to capillary electrophoresis. After diluting the PCR products with water, they were separated on an ABI 3100 capillary sequencer at the Central Services Laboratory (OSU).

Scoring Method
GeneScan version 2.1 and Genotyper version 2.0 were used for automated data collection and computation of allele size and accurate visualization of the alleles, respectively. Alleles were scored by fitting the peaks into bins of less than 1 nucleotide.

Number of Observed Alleles
9

Size of Alleles
147


Assay details for evaluation CORYLUS.PARLIER.BASSIL.ACTA.2009
Evaluation Method
The US Department of Agriculture (USDA), Agricultural Research Service maintains a genebank representing world hazelnut (Corylus L.) diversity. More than 670 clones are preserved as self-rooted trees in a two-hectare field planting in Corvallis, Oregon, with a single tree per accession. In 1996 and 1997, prior to the spread of eastern filbert blight caused by Anisogramma anomala to within 75 kilometers of Corvallis, a backup collection was established in Parlier, California. A core collection of 184 genotypes representing the wide taxonomic, geographic and phenotypic diversity of Corylus was targeted for this second planting. Two trees of each `core? genotype were grafted onto seedling rootstocks over a period of five years and an orchard was established in Parlier. The grafted trees in Parlier are at risk of identity problems due to suckers arising from below the graft union. In May 2007, young leaves were collected from 29 Parlier trees that exhibited uncharacteristic morphological phenotypes. A set of 12 simple sequence repeat (SSR) markers was used to fingerprint trees in the backup collection, and the results were compared to the fingerprints of the same accessions in the Corvallis collection. Based on the results, misidentified accessions were eliminated and the fingerprinting set will be refined further. The results of this study were presented at the VIIth ISHS International Congress on Hazelnut, in Viterbo, Italy and published in Acta Horticulturae 845: 95-102.

Assay Method
DNA was extracted from young, actively growing hazelnut leaves using a Puregene kit (Gentra Systems, Inc., Minneapolis, Minnesota) and a modified protocol developed in our laboratory for which details are available from the senior author. PCR reactions were carried out for each primer pair in an Eppendorf Gradient thermocycler (Eppendorf, Westbury, NY) or an MJ Research (Watertown, Mass.) Tetrad thermocycler. The forward primers were fluorescently labeled with D2, D3 or D4 WellRED dyes obtained from Sigma-Aldrich Inc. (Saint Louis, MO). The 15 ?l reaction volume contained 1X Biolase buffer, 3 mM MgCl2, 300 ?M each of dATP, dCTP, dGTP, and dTTP, 0.45 ?M each of forward and reverse primers, 0.375 units of Biolase Taq DNA polymerase (Bioline Inc., Randolph, MA), and 4 ng of template DNA. The PCR program consisted of 35 cycles of 94?C for 40 s, optimum Ta for 40 s and 72?C for 40 s. A final extension at 72?C for 30 min was used to maximize non-templated adenosine addition to the 5? ends. Once amplification was confirmed by 3% agarose gel electrophoresis, a small amount of PCR product (0.25 ?l for D4-; 0.5 ?l for D3-; and 1 ?l for D2-labeled fragments) was pooled for each multiplex and the mixture was separated by capillary electrophoresis using a Beckman CEQ 8000 genetic analyzer (Beckman Coulter, Inc., Fullerton, CA).

Scoring Method
Allele sizing and visualization was performed using the fragment analysis module of the Beckman CEQ 8000 software. Alleles were scored by fitting the peaks into bins of less than 1 nucleotide.