View | Download this marker

Marker details for GD12-A

Crop Name APPLE
Site Natl. Germplasm Repository - Geneva
Repeat Motif (CT)32
Primers 5' F: TTGAGGTGTTTCTCCCATTGGA; 3'R: GTTTCTTCTAACGAAGCCGCCATTTCTTT
Assay Conditions Extract DNA from leaves, PCR amplify in Perkin Elmer 9600 thermocycler. Multiplexed primer sets are Primer Mix 1 (GD12-A labeled with 6-FAM(blue), GD142-A labeled with PET(red), CH01h01-A labeled with NED(yellow/black)), Primer Mix 2 (GD147-A labeled with PET(red), GD15-A labeled with VIC(green), CH01f02-A labeled with NED(yellow/black)), and Primer Mix 3 (GD162-A labeled with PET(red), GD96-A labeled with VIC(green), CH02d08-A labeled with 6-FAM(blue)). PCR amplified 5uL reaction mixtures containing 2 uL (2-10 ng) DNA, 2.5 uL mastermix (Qiagen multiplex PCR kit), 0.5 uL primer mix (PM1, PM2, or PM3, all primers 0.5 uM). PCR cycle: 95C for 15 min; followed by 40 cycles of 94C (1 min), 55C (1.5 min), 72C (1 min); and a final extension at 72C for 10 min. Hold at 4C for 15 min, hold at 12C. . PCR products were separated using an ABI 3730 capillary sequencer (Thermo Fisher Scientific, Waltham, MA), and the Liz 500 size standard (Thermo Fisher Scientific, Waltham, MA). Control samples were Golden Delicious (PI 590184), Rome Beauty Law (PI 588850), and Cox's Orange Pippin (PI 588853). Resulting chromatograms were analyzed to determine microsatellite allele sizes using a partially automated binning system software (Gene Mapper version 5, Thermo Fisher Scientific). Automated binning was set to a range of ± 0.4 to ensure that alleles differing by a single base pair were correctly scored.
Range Products 143-203
Polymorphic Type MICROSATELLITE

Citation(s)
  • Hokanson, S. C., A. K. Szewc-McFadden, W. F. Lamboy, & J. R. McFerson. 1998. Microsatellite (SSR) markers reveal genetic identities, genetic diversity and relationships in a Malus x domestica borkh. core subset collection. Theor. Appl. Genet. 97:671-683.

Assay details for evaluation 2020Malus-SSR
Assay Method
Extract DNA from leaves, PCR amplify in Perkin Elmer 9600 thermocycler. Multiplexed primer sets are Primer Mix 1 (GD12-A labeled with 6-FAM(blue), GD142-A labeled with PET(red), CH01h01-A labeled with NED(yellow/black)), Primer Mix 2 (GD147-A labeled with PET(red), GD15-A labeled with VIC(green), CH01f02-A labeled with NED(yellow/black)), and Primer Mix 3 (GD162-A labeled with PET(red), GD96-A labeled with VIC(green), CH02d08-A labeled with 6-FAM(blue)). PCR amplified 5uL reaction mixtures containing 2 uL (2-10 ng) DNA, 2.5 uL mastermix (Qiagen multiplex PCR kit), 0.5 uL primer mix (PM1, PM2, or PM3, all primers 0.5 uM). PCR cycle: 95C for 15 min; followed by 40 cycles of 94C (1 min), 55C (1.5 min), 72C (1 min); and a final extension at 72C for 10 min. Hold at 4C for 15 min, hold at 12C. . PCR products were separated using an ABI 3730 capillary sequencer (Thermo Fisher Scientific, Waltham, MA), and the Liz 500 size standard (Thermo Fisher Scientific, Waltham, MA). Control samples were Golden Delicious (PI 590184), Rome Beauty Law (PI 588850), and Cox's Orange Pippin (PI 588853).

Scoring Method
Resulting chromatograms were analyzed to determine microsatellite allele sizes using a partially automated binning system software (Gene Mapper version 5, Thermo Fisher Scientific). Automated binning was set to a range of ± 0.4 to ensure that alleles differing by a single base pair were correctly scored.

Control Value
Cox Orange Pippin: 155, 159; Golden Delicious: 155,195; Rome Beauty Law: 155,157