View | Download this marker

Marker details for NA172a

Crop Name VACCINIUM
Site National Clonal Germplasm Repository
Repeat Motif (CAT)5
Primers F: D4-CCTCGTCCTCCTCTTCCTCT R: GTTTGACTTTGGAGAAGGCGAAG
Polymorphic Type MICROSATELLITE

Citation(s)

Assay details for evaluation 2019 10-SSR Blueberry
Evaluation Method
Leaves were collected from 299 actively growing plants representing 143 accessions that are preserved in greenhouses, screenhouses, or field collections at the USDA-ARS, NCGR, Corvallis, OR. Leaf samples were also obtained for an additional 68 plants from two nurseries (9 from N1; 11 from N2), and breeders across the US including Oregon (Chad Finn, 2, OR), Minnesota (Jim Luby, 1, MN), Mississippi (Stephen Stringer, 6, MS), North Carolina (Hamid Ashrafi, 8, NC), and New Jersey (Mark Ehlenfeldt, 28, NJ). DNA was extracted from young leaves of these 363 plants using a modified Qiagen protocol described in detail by Gilmore et al. (2011). DNA amplification with the 5-SSR or the 10-SSR multiplex was performed with the Type-it Multiplex PCR mix (Qiagen Inc., Valencia, CA, USA) as detailed by Bidani et al., 2017. DNA was amplified in an Eppendorf Gradient thermocycler (Eppendorf, Westbury, NY, USA) or an MJ Research Tetrad thermocycler (BioRad, Hercules, CA, USA). The PCR protocol consisted of a “touchdown” program with an initial denaturation cycle at 94 ºC for 3 min followed by ten cycles of 40 sec at 94 °C; 45 sec at 62 °C, decreasing 1 °C each cycle; and 45 sec at 72 °C. PCR continued for an additional 28 cycles of 40 sec at 94 °C; 45 sec at 52 °C; and 45 sec at 72 °C; followed by a final extension at 72 °C for 30 min. Once amplification success was verified by 2% agarose gel electrophoresis, PCR products were pooled and separated by capillary electrophoresis with a Beckman CEQ 8000 (Beckman Coulter, Inc.). In all cases, allele sizing and visualization were performed using the fragment analysis module of the CEQ 8000 software. Individuals were scored by grouping PCR fragment sizes (alleles) into bins of less than one base pair.