| Crop Name |
PEA |
| Site |
Western Regional PI Station |
| Repeat Motif |
CCT |
| Primers |
F= ggtgccctagcatttgtctg R= tagtaacaaccgcgctcaaa |
| Assay Conditions |
DNA was isolated from ten field grown plants of each accession using a modified CTAB procedure (Murray and Thompson, 1980). Fifteen microsatellite primer pairs (Burstin et al., 2001) were labeled with the infrared dye IRD 700 or IRD 800 (Li-cor, Lincoln, Neb., USA). PCR reactions contained 25 ng DNA template in 1.5 mM MgCl2, 1X PCR buffer, 150 5M each dNTP, 0.1 U Taq polymerase and 0.2 5M each primer in a total volume of 105l. PCR was performed on a Appplied Biosystems GeneAmp 9700 PCR System under the following step-down program: 30 s denaturation cycle at 94:C, 15 cycles of 10 s denaturation at 94:C, 30 s annealing beginning at 65:C and decreasing a degree each cycle to 51:C, then a 30 s elongation step at 72:C, followed by 20 cycles of 1 0s denaturation step at 94:C, 30 s annealing at 50:C and elongation for 30 s at 72:C. Electrophoreses of the PCR products were performed on the LiCor Global Edition IR2 DNA Analyzer Gene Readir 4200 at 1500V for 200 minutes using 6.5% denaturing polyacrylamide gel. |
| Range Products |
183-189 |
| Genbank Number |
M69105 |
| Polymorphic Type |
MICROSATELLITE |