View | Download this marker

Marker details for PSGAP1

Crop Name PEA
Site Western Regional PI Station
Repeat Motif AT
Primers F= gacattgttgccaataactgg R= ggttctgttctcaatacaag
Assay Conditions DNA was isolated from ten field grown plants of each accession using a modified CTAB procedure (Murray and Thompson, 1980). Fifteen microsatellite primer pairs (Burstin et al., 2001) were labeled with the infrared dye IRD 700 or IRD 800 (Li-cor, Lincoln, Neb., USA). PCR reactions contained 25 ng DNA template in 1.5 mM MgCl2, 1X PCR buffer, 150 5M each dNTP, 0.1 U Taq polymerase and 0.2 5M each primer in a total volume of 105l. PCR was performed on a Appplied Biosystems GeneAmp 9700 PCR System under the following step-down program: 30 s denaturation cycle at 94:C, 15 cycles of 10 s denaturation at 94:C, 30 s annealing beginning at 65:C and decreasing a degree each cycle to 51:C, then a 30 s elongation step at 72:C, followed by 20 cycles of 1 0s denaturation step at 94:C, 30 s annealing at 50:C and elongation for 30 s at 72:C. Electrophoreses of the PCR products were performed on the LiCor Global Edition IR2 DNA Analyzer Gene Readir 4200 at 1500V for 200 minutes using 6.5% denaturing polyacrylamide gel.
Range Products 149-153
Genbank Number X15190
Polymorphic Type MICROSATELLITE

Citation(s)

Assay details for evaluation PEA.SSR.2012.COYNE
Evaluation Method
The USDA Western Regional Plant Introduction Station in Pullman, WA maintains >6800 pea accessions including three species, genetic stocks and several core collections. The biodiversity held in this germplasm fuels advances in the plant sciences, particularly breeding and genetics in the pursuit of crop improvement. Efficient germplasm management is crucial and molecular characterization using 15 SSRs of the USDA pea core collection of 310 accessions assists utilization. Understanding the genetic diversity (population structure) of the highly phenotyped USDA pea core collection led to significant marker-trait associations. The results of this study were published in Genes & Genomics 34(3): 305-320.

For a .xls file of the SSR data