Marker details for B665

Crop Name HAZELNUT
Site National Clonal Germplasm Repository
Repeat Motif (CT)17
Primers F: 5'GCAACCACCAAATTGCACTA3' R: 5'GCTTTTAAAGTCCACGCATGA3'
Assay Conditions DNA was extracted from fresh hazelnut leaves according to Lunde et al. (2000). Forward primers for the 21 SSRs were fluorescently labeled with FAM, HEX or NED. Polymerase chain reactions (PCRs) were carried out in a 10 �l volume containing 0.5 �M of primer, 20 ng of template DNA, 0.2 U of Biolase DNA polymerase (Biolase USA, Randolph, MA), 1.5 mM MgCl2 ,120 �M each of dATP, dCTP, dGTP and dTTP and the 1� ammonium-based buffer supplied by the manufacturer. The thermal cycler program of an initial 4 min at 95 oC followed by 40 cycles of 30s at 95 oC, 40 s at the optimum annealing temperature, 40s at 72 oC; 7 min at 72 oC, and ending with an indefinite hold at 4 oC until retrieved from the thermal cycler. Two microliters of labeled PCR product from each primer pair in a multiplex set were combined with autoclaved nanopure water to a final volume of 150 �l. A one �l aliquot of the mixture was separated using an ABI 3730 DNA Analyzer (Applied Biosystems, Life Technologies Corporation, Carlsbad, CA) at the Core Laboratories of the Center for Genome Research and Biocomputing (CGRB) at Oregon State University. Fragment analysis was carried out using Peak ScannerTM Software v 1.0 (Applied Biosystems, Life Technologies Corporation, Carlsbad, CA) and the values were manually entered into a spreadsheet.
Range Products 177-203
Map location 8
Polymorphic Type MICROSATELLITE

Citation(s)

Assay details for evaluation CORYLUS.CORVALLIS.SATHURALLI.GRCE.2011
Evaluation Method
The objective of this study was to use 21 SSR loci to evaluate genetic diversity in 87 accessions of American hazelnut (Corylus americana) and 68 hybrids between American and European hazelnuts representing a wide geographic range from the USDA-ARS NCGR National collection, OSU hazelnut breeding collection and Arbor Day Foundation. The results of this study were published in Genetic Resources and Crop Evolution DOI 10.1007/s10722-011-9743-0.

Assay Method
DNA was extracted from fresh hazelnut leaves according to Lunde et al. (2000). Forward primers for the 21 SSRs were fluorescently labeled with FAM, HEX or NED. Polymerase chain reactions (PCRs) were carried out in a 10 ?l volume containing 0.5 ?M of primer, 20 ng of template DNA, 0.2 U of Biolase DNA polymerase (Biolase USA, Randolph, MA), 1.5 mM MgCl2 ,120 ?M each of dATP, dCTP, dGTP and dTTP and the 1? ammonium-based buffer supplied by the manufacturer. The thermal cycler program of an initial 4 min at 95 oC followed by 40 cycles of 30s at 95 oC, 40 s at the optimum annealing temperature, 40s at 72 oC; 7 min at 72 oC, and ending with an indefinite hold at 4 oC until retrieved from the thermal cycler. Two microliters of labeled PCR product from each primer pair in a multiplex set were combined with autoclaved nanopure water to a final volume of 150 ?l. A one ?l aliquot of the mixture was separated using an ABI 3730 DNA Analyzer (Applied Biosystems, Life Technologies Corporation, Carlsbad, CA) at the Core Laboratories of the Center for Genome Research and Biocomputing (CGRB) at Oregon State University. Fragment analysis was carried out using Peak ScannerTM Software v 1.0 (Applied Biosystems, Life Technologies Corporation, Carlsbad, CA) and the values were manually entered into a spreadsheet.

Scoring Method
DNA fragment sizes were determined using Peak Scanner TM software.

Number of Observed Alleles
13