View | Download this marker

Marker details for CD277232

Crop Name HAZELNUT
Site National Clonal Germplasm Repository
Repeat Motif (CT)14
Primers F= 5'GCAATTTCTACCAAACAGAACC3' R= 5'CTCTGGATCCAACGGTCAAG3'
Assay Conditions DNA from Corylus accessions and the mapping population was extracted from young leaves of field-planted trees, as described by Davis et al. (1998) and modified by Lunde et al. (2000). Polymerase chain reactions (PCRs) were conducted in a 15-?L PCR mixture containing 0.3 ?M each of fluorescently-labeled (6-FAM, HEX, or NED) forward and reverse primers, 1 x Biolase NH4 reaction buffer, 3 mM MgCl2, 200 ?M of each dNTP, 3 to 5 ng of template DNA, and 0.25 units of Biolase DNA polymerase (Bioline, Randolph, MA). The thermocycler was programmed to denature DNA at 94 ?C for 3 min, followed by 40 cycles of 94 ?C for 40 s, annealing temperature for 60 s, 72 ?C for 60 s, and a final 7-min extension step at 72 ?C. The products were separated on 3% agarose gels to verify amplification and polymorphism. A mapping population of 144 seedlings (Mehlenbacher et al. 2006) was amplified at polymorphic SSR loci using fluorescently labeled primers and the same PCR conditions as for characterization. Up to four PCR products were diluted, pooled and the mixture was submitted to the Central Services Laboratory (CSL) of the Center for Genome Research and Biocomputing (CGRB) at OSU where fragments were separated and sized with an ABI 3100 capillary electrophoresis instrument. DNA fragment sizes were determined using GeneScan and Genotyper software.
Range Products 360�408
Genbank Number CD277232
Map location 3
Polymorphic Type MICROSATELLITE
Comment Betula locus from GenBank sequences

Citation(s)
  • Study of: CORYLUS.CORVALLIS.GURCAN.JASHS.2010. Acta Hort.

Assay details for evaluation CORYLUS.CORVALLIS.GURCAN.JASHS.2010
Evaluation Method
Study Name: CORYLUS.CORVALLIS.GURCAN.JASHS.2010

Assay Method
DNA from Corylus accessions and the mapping population was extracted from young leaves of field-planted trees, as described by Davis et al. (1998) and modified by Lunde et al. (2000). Polymerase chain reactions (PCRs) were conducted in a 15-?L PCR mixture containing 0.3 ?M each of fluorescently-labeled (6-FAM, HEX, or NED) forward and reverse primers, 1 x Biolase NH4 reaction buffer, 3 mM MgCl2, 200 ?M of each dNTP, 3 to 5 ng of template DNA, and 0.25 units of Biolase DNA polymerase (Bioline, Randolph, MA). The thermocycler was programmed to denature DNA at 94 ?C for 3 min, followed by 40 cycles of 94 ?C for 40 s, annealing temperature for 60 s, 72 ?C for 60 s, and a final 7-min extension step at 72 ?C. The products were separated on 3% agarose gels to verify amplification and polymorphism. A mapping population of 144 seedlings (Mehlenbacher et al. 2006) was amplified at polymorphic SSR loci using fluorescently labeled primers and the same PCR conditions as for characterization. Up to four PCR products were diluted, pooled and the mixture was submitted to the Central Services Laboratory (CSL) of the Center for Genome Research and Biocomputing (CGRB) at OSU where fragments were separated and sized with an ABI 3100 capillary electrophoresis instrument.

Scoring Method
DNA fragment sizes were determined using GeneScan and Genotyper software.

Number of Observed Alleles
12

Size of Alleles
360�408