View | Download this marker

Marker details for PYC-010B

Crop Name PEAR
Site National Clonal Germplasm Repository
Repeat Motif (TTTA)4(TTA)6
Primers F: 5'CACATGGATACTTTGGACAAGC3' R: 5'GTTTGGAGTGAAATCTAATCCTTGC3'
Assay Conditions DNA was extracted from actively growing leaves collected from the NCGR field in the spring using a modified PUREGENE? kit (Gentra Systems Inc., MN) protocol. Out of 18 SSR primer pairs developed from pear sequences mined from GenBank, 13 SSRs amplified in each of the three species evaluated in this study and were further characterized. PCR reactions were carried out separately for each primer pair and up to three PCR products (one per SSR primer set) were pooled in a multiplex and separated using capillary electrophoresis. PCR reactions for primers PYC-001, PYC-002, PYC-003, PYC-004, PYC-006, PYC-007a, PYC-009, PYC-012 and PYC-013 were carried out in 10 ?L volumes using fluorescently labeled forward primers (FAM, HEX, or NED) and unlabeled reverse primers. After diluting the PCR products with water, they were separated on an ABI 3100 capillary sequencer at the Central Services Laboratory (OSU). GeneScan version 2.1 and Genotyper version 2.0 were used for automated data collection and computation of allele size and accurate visualization of the alleles, respectively. The amplification products of the four remaining primers were analyzed using a CEQ 8000 genetic analyzer. PCR reactions were carried out in 15 ?L volumes for each primer pair using Well-RED-labeled forward primers and unlabeled reverse primers. Allele sizing and visualization were performed using the fragment analysis module of the CEQ 8000 software. PCR reactions contained per 10 ?L total volume 1X reaction buffer, 2 mM MgCl2, 0.2 mM dNTPs, 0.3 ?M of each primer, 0.25 units of Biolase Taq DNA polymerase, and 2.5 ng genomic DNA. The PCR protocol consisted of one cycle of initial denaturation at 94 ?C for 3 min, followed by 35 cycles of denaturation at 93 ?C for 40 s, annealing at optimum Ta for 40 s, and extension at 72 ?C for 40 s. A final extension cycle at 72 ?C for 30 min followed. DNA was amplified in an Eppendorf Gradient thermocycler or an MJ Research Tetrad thermocycler. The success of the PCR reaction was verified by 2% agarose gel electrophoresis prior to capillary electrophoresis.
Range Products 327-339
Polymorphic Type MICROSATELLITE

Citation(s)
  • Study of: PYRUS.CORVALLIS.BASSIL.GRCE.2010. Acta Hort.

Assay details for evaluation PYRUS.CORVALLIS.BASSIL.GRCE.2010
Evaluation Method
In this study, ten EST-SSRs previously isolated from Pyrus GenBank sequences were used to identify 81 P. communis, 13 P. pyrifolia and 20 P. ussuriensis or P. ?bretschneideri accessions. Cross-transference of these EST-SSRs was high in these species. PYC-008 and PYC-004 were the least informative SSRs in each of the pear species and were monomorphic in P. pyrifolia while PYC-013, PYC-002 and PYC-009b were the most informative in all species. EST-SSRs were very valuable for identification of incorrectly identified accessions, failed grafts and sets of synonyms in each of the species. Unsuspected relationships were uncovered, including a parental relationship between `Anjou? and `Farmingdale?, a clonal relationship between `Berger? and `Bartlett?, and a very close relationship between `Beurre Superfin? and `Doyenne du Comice?. One SSR marker was different in one of three sports of `Doyenne du Comice? (`Doyenne du Comice Crimson Gem?) and in one of two sports of `Anjou? (`Gebhard Red? red skin sport of `Anjou?). High cross-transference of EST-SSRs in Pyrus species is very valuable for germplasm management in such a highly diverse collection as found at the NCGR Pyrus genebank in Corvallis, OR. The results of this study were published in Genetic Resources and Crop Evolution 57:357-370.

Assay Method
DNA was extracted from actively growing leaves collected from the NCGR field in the spring using a modified PUREGENE? kit protocol. Out of 18 SSR primer pairs developed from pear sequences mined from GenBank, 13 SSRs amplified in each of the three species evaluated in this study and were further characterized. PCR reactions were carried out separately for each primer pair and up to three PCR products were pooled in a multiplex and separated using capillary electrophoresis. PCR reactions for primers PYC-001, PYC-002, PYC-003, PYC-004, PYC-006, PYC-007a, PYC-009, PYC-012 and PYC-013 were carried out in 10 ?L volumes using fluorescently labeled forward primers (FAM, HEX, or NED) and unlabeled reverse primers. After diluting the PCR products with water, they were separated on an ABI 3100 capillary sequencer at the Central Services Laboratory (OSU). GeneScan version 2.1 and Genotyper version 2.0 were used for automated data collection and computation of allele size and accurate visualization of the alleles, respectively. The amplification products of the four remaining primers were analyzed using a CEQ 8000 genetic analyzer. PCR reactions were carried out in 15 ?L volumes for each primer pair using Well-RED-labeled forward primers and unlabeled reverse primers. Allele sizing and visualization were performed using the CEQ 8000 software. PCR reactions contained per 10 ?L total volume 1X reaction buffer, 2 mM MgCl2, 0.2 mM dNTPs, 0.3 ?M of each primer, 0.25 units of Biolase Taq DNA polymerase, and 2.5 ng genomic DNA. The PCR protocol consisted of one cycle of initial denaturation at 94 ?C for 3 min, followed by 35 cycles of denaturation at 93 ?C for 40 s, annealing at optimum Ta for 40 s, and extension at 72 ?C for 40 s. A final extension cycle at 72 ?C for 30 min followed. The success of the PCR reaction was verified by 2% agarose gel electrophoresis prior to capillary electrophoresis.

Scoring Method
For products separated using the ABI 3100 capillary sequencer, GeneScan version 2.1 and Genotyper version 2.0 were used for automated data collection and computation of allele size and accurate visualization of the alleles, respectively. Other products separated with the Beckman CEQ 8000 genetic analyzer, allele sizing and visualization was performed using the fragment analysis module of the Beckman CEQ 8000 software. Alleles were scored by fitting the peaks into bins of less than 1 nucleotide.

Number of Observed Alleles
5