View | Download this marker

Marker details for B617

Crop Name HAZELNUT
Site National Clonal Germplasm Repository
Repeat Motif (GA)15
Primers F= 5'TCCGTGTTGAGTATGGACGA3' R= 5'TGTTTTTGGTGGAGCGATG3'
Assay Conditions The backup Corylus planting at NALPGR was surveyed in May 2007 for identity problems. Accessions with two plants that did not match, or with two distinct forms in a single tree suggesting growth of both scion and rootstock suckers, were sampled for DNA fingerprinting. Young leaf tissue was collected in the Spring, and returned in a refrigerated container to the NCGR in Corvallis. DNA was extracted from young, actively growing hazelnut leaves using a Puregene kit (Gentra Systems, Inc., Minneapolis, Minnesota) and a modified protocol developed in our laboratory for which details are available from the senior author. Leaves from 29 trees growing in the Parlier collection were sampled including two trees each of `Negret? and `Artellet?. SSR-based genetic fingerprints of these trees were compared to those of their 27 mother trees in the main field collection in Corvallis, Oregon. Twelve SSR primer pairs were chosen based on the ease of allele scoring, multiplexing ability, and linkage group assignment. Primers for CAT-B501, CAC-B028, CAC-C028, and CAC-A040 were previously published while the remaining seven loci were developed by Kahraman Gurcan and Shawn Mehlenbacher. PCR reactions were carried out for each primer pair in an Eppendorf Gradient thermocycler (Eppendorf, Westbury, NY) or an MJ Research (Watertown, Mass.) Tetrad thermocycler. The forward primers were fluorescently labeled with D2, D3 or D4 WellRED dyes obtained from Sigma-Aldrich Inc. (Saint Louis, MO). The 15 ?l reaction volume contained 1X Biolase buffer, 3 mM MgCl2, 300 ?M each of dATP, dCTP, dGTP, and dTTP, 0.45 ?M each of forward and reverse primers, 0.375 units of Biolase Taq DNA polymerase (Bioline Inc., Randolph, MA), and 4 ng of template DNA. The PCR program consisted of 35 cycles of 94?C for 40 s, optimum Ta for 40 s and 72?C for 40 s. A final extension at 72?C for 30 min was used to maximize non-templated adenosine addition to the 5? ends. Once amplification was confirmed by 3% agarose gel electrophoresis, a small amount of PCR product (0.25 ?l for D4-; 0.5 ?l for D3-; and 1 ?l for D2-labeled fragments) was pooled for each multiplex and the mixture was separated by capillary electrophoresis using a Beckman CEQ 8000 genetic analyzer (Beckman Coulter, Inc., Fullerton, CA). The CEQ 8000 software was used for allele size estimation.
Range Products 284-300
Map location 8
Polymorphic Type MICROSATELLITE

Citation(s)
  • Gökirmak, T., S. A. Mehlenbacher, & N. V. Bassil. 2009. Characterization of European hazelnut (Corylus avellana) cultivars using SSR markers. Genet. Resources Crop Evol. 46:147-172. DOI: 10.1007/s10722-008-9352-8. Note: Corvallis
  • Gökirmak, T., S. A. Mehlenbacher, & N. V. Bassil. 2009. Characterization of European hazelnut (Corylus avellana) cultivars using SSR markers. Genet. Resources Crop Evol. 46:147-172. DOI: 10.1007/s10722-008-9352-8. Note: Parlier

Assay details for evaluation CORYLUS.CORVALLIS.BASSIL.ACTA.2009
Evaluation Method
The US Department of Agriculture (USDA), Agricultural Research Service maintains a genebank representing world hazelnut (Corylus L.) diversity. More than 670 clones are preserved as self-rooted trees in a two-hectare field planting in Corvallis, Oregon, with a single tree per accession. In 1996 and 1997, prior to the spread of eastern filbert blight caused by Anisogramma anomala to within 75 kilometers of Corvallis, a backup collection was established in Parlier, California. A core collection of 184 genotypes representing the wide taxonomic, geographic and phenotypic diversity of Corylus was targeted for this second planting. Two trees of each `core? genotype were grafted onto seedling rootstocks over a period of five years and an orchard was established in Parlier. The grafted trees in Parlier are at risk of identity problems due to suckers arising from below the graft union. In May 2007, young leaves were collected from 29 Parlier trees that exhibited uncharacteristic morphological phenotypes. A set of 12 simple sequence repeat (SSR) markers was used to fingerprint trees in the backup collection, and the results were compared to the fingerprints of the same accessions in the Corvallis collection. Based on the results, misidentified accessions were eliminated and the fingerprinting set will be refined further. The results of this study were presented at the VIIth ISHS International Congress on Hazelnut, in Viterbo, Italy and published in Acta Horticulturae 845: 95-102.

Assay Method
DNA was extracted from young, actively growing hazelnut leaves using a Puregene kit (Gentra Systems, Inc., Minneapolis, Minnesota) and a modified protocol developed in our laboratory for which details are available from the senior author. PCR reactions were carried out for each primer pair in an Eppendorf Gradient thermocycler (Eppendorf, Westbury, NY) or an MJ Research (Watertown, Mass.) Tetrad thermocycler. The forward primers were fluorescently labeled with D2, D3 or D4 WellRED dyes obtained from Sigma-Aldrich Inc. (Saint Louis, MO). The 15 ?l reaction volume contained 1X Biolase buffer, 3 mM MgCl2, 300 ?M each of dATP, dCTP, dGTP, and dTTP, 0.45 ?M each of forward and reverse primers, 0.375 units of Biolase Taq DNA polymerase (Bioline Inc., Randolph, MA), and 4 ng of template DNA. The PCR program consisted of 35 cycles of 94?C for 40 s, optimum Ta for 40 s and 72?C for 40 s. A final extension at 72?C for 30 min was used to maximize non-templated adenosine addition to the 5? ends. Once amplification was confirmed by 3% agarose gel electrophoresis, a small amount of PCR product (0.25 ?l for D4-; 0.5 ?l for D3-; and 1 ?l for D2-labeled fragments) was pooled for each multiplex and the mixture was separated by capillary electrophoresis using a Beckman CEQ 8000 genetic analyzer (Beckman Coulter, Inc., Fullerton, CA).

Scoring Method
Allele sizing and visualization was performed using the fragment analysis module of the Beckman CEQ 8000 software. Alleles were scored by fitting the peaks into bins of less than 1 nucleotide.

Number of Observed Alleles
8

Size of Alleles
284-300


Assay details for evaluation CORYLUS.PARLIER.BASSIL.ACTA.2009
Evaluation Method
The US Department of Agriculture (USDA), Agricultural Research Service maintains a genebank representing world hazelnut (Corylus L.) diversity. More than 670 clones are preserved as self-rooted trees in a two-hectare field planting in Corvallis, Oregon, with a single tree per accession. In 1996 and 1997, prior to the spread of eastern filbert blight caused by Anisogramma anomala to within 75 kilometers of Corvallis, a backup collection was established in Parlier, California. A core collection of 184 genotypes representing the wide taxonomic, geographic and phenotypic diversity of Corylus was targeted for this second planting. Two trees of each `core? genotype were grafted onto seedling rootstocks over a period of five years and an orchard was established in Parlier. The grafted trees in Parlier are at risk of identity problems due to suckers arising from below the graft union. In May 2007, young leaves were collected from 29 Parlier trees that exhibited uncharacteristic morphological phenotypes. A set of 12 simple sequence repeat (SSR) markers was used to fingerprint trees in the backup collection, and the results were compared to the fingerprints of the same accessions in the Corvallis collection. Based on the results, misidentified accessions were eliminated and the fingerprinting set will be refined further. The results of this study were presented at the VIIth ISHS International Congress on Hazelnut, in Viterbo, Italy and published in Acta Horticulturae 845: 95-102.

Assay Method
DNA was extracted from young, actively growing hazelnut leaves using a Puregene kit (Gentra Systems, Inc., Minneapolis, Minnesota) and a modified protocol developed in our laboratory for which details are available from the senior author. PCR reactions were carried out for each primer pair in an Eppendorf Gradient thermocycler (Eppendorf, Westbury, NY) or an MJ Research (Watertown, Mass.) Tetrad thermocycler. The forward primers were fluorescently labeled with D2, D3 or D4 WellRED dyes obtained from Sigma-Aldrich Inc. (Saint Louis, MO). The 15 ?l reaction volume contained 1X Biolase buffer, 3 mM MgCl2, 300 ?M each of dATP, dCTP, dGTP, and dTTP, 0.45 ?M each of forward and reverse primers, 0.375 units of Biolase Taq DNA polymerase (Bioline Inc., Randolph, MA), and 4 ng of template DNA. The PCR program consisted of 35 cycles of 94?C for 40 s, optimum Ta for 40 s and 72?C for 40 s. A final extension at 72?C for 30 min was used to maximize non-templated adenosine addition to the 5? ends. Once amplification was confirmed by 3% agarose gel electrophoresis, a small amount of PCR product (0.25 ?l for D4-; 0.5 ?l for D3-; and 1 ?l for D2-labeled fragments) was pooled for each multiplex and the mixture was separated by capillary electrophoresis using a Beckman CEQ 8000 genetic analyzer (Beckman Coulter, Inc., Fullerton, CA).

Scoring Method
Allele sizing and visualization was performed using the fragment analysis module of the Beckman CEQ 8000 software. Alleles were scored by fitting the peaks into bins of less than 1 nucleotide.