View | Download this marker

Marker details for CH01H10

Crop Name QUINCE
Site National Clonal Germplasm Repository
Repeat Motif (AG)21
Primers F= 5'TGCAAAGATAGGTAGATATATGCCA3' R= 5'AGGAGGGATTGTTTGTGCAC3'
Assay Conditions DNA was extracted from fresh leaves using a modified PUREGENE? kit (Gentra Systems Inc., MN) protocol routinely used at the NCGR. DNA samples were further cleaned up with a Nucleon resin (Illusta Nucleon Phytopure Genomic DNA Extraction Kit; GE Healthcare). Nine apple primer pairs that amplify in pear and appeared polymorphic in quince were used. PCR reactions were carried out in three multiplexes in 10 ?L volumes containing 0.2 ?M of each fluorescently labeled forward primer (D2, D3, or D4) and unlabeled reverse primer, 2X Type-it Multiplex PCR Master Mix (Qiagen), and 30 ng genomic DNA. The `Touchdown? protocol was used for PCR amplification. The PCR protocol consisted of one cycle of initial denaturation at 95?C for 5 min followed by 28 cycles of denaturation at 95?C for 30 s, annealing at 57?C for 1 min 30 s, and extension at 72?C for 30 s. A final extension cycle at 60?C for 30 min followed. DNA was amplified in an Eppendorf Gradient thermocycler (Brinkmann Instruments, Inc., Westbury, NY) or an MJ Research Tetrad thermocycler (MJ Research Inc., Watertown, MA). The success of the PCR reaction was verified by agarose (2%) gel electrophoresis prior to capillary electrophoresis using the CEQ 8000 (Beckman Coulter Inc., Fullerton, CA). Allele sizing and visualization were performed using the fragment analysis module of the CEQ 8000 software. Alleles were scored by fitting peaks into bins less than 1 nucleotide.
Range Products 95-111
Map location 8
Polymorphic Type MICROSATELLITE
Comment Map location in Fiesta x Discovery apple population

Citation(s)
  • Bassil, N. V., J. Postman, K. Hummer, J. Nota, D. Sugar, & R. Williams. 2011. Quince (Cydonia oblonga) Genetic Relationships Determined Using Microsatellite Markers. Acta Hort. 909:75-83. DOI: 10.17660/ActaHortic.2011.909.6. Note: in press

Assay details for evaluation CYDONIA.CORVALLIS.BASSIL.ACTA.2010
Evaluation Method
The USDA-ARS National Clonal Germplasm Repository in Corvallis, Oregon has assembled a diverse living collection of Cydonia genotypes originating from more than 15 countries, and maintained as self-rooted orchard trees. We evaluated 24 apple SSR primer pairs that also amplify in pear for cross-transference to 45 diverse quince accessions from the Corvallis collection. Nine apple primer pairs that appeared polymorphic in quince were selected and used to evaluate genetic relationships among 92 quince genotypes and 3 intergeneric pear x quince hybrids (?Pyronia veitchii (Trab.) Guillaumin). The results of this study were presented at the ISHS XI International Pear Symposium, Patagonia, Argentina in November, 2010 and accepted for publication in Acta Horticulturae.

Assay Method
DNA was extracted from fresh leaves using a modified PUREGENE? kit (Gentra Systems Inc., MN) protocol routinely used at the NCGR. DNA samples were further cleaned up with a Nucleon resin (Illusta Nucleon Phytopure Genomic DNA Extraction Kit; GE Healthcare). PCR reactions were carried out in three multiplexes in 10 ?L volumes containing 0.2 ?M of each fluorescently labeled forward primer (D2, D3, or D4) and unlabeled reverse primer, 2X Type-it Multiplex PCR Master Mix (Qiagen), and 30 ng genomic DNA. The `Touchdown? protocol was used for PCR amplification. The PCR protocol consisted of one cycle of initial denaturation at 95?C for 5 min followed by 28 cycles of denaturation at 95?C for 30 s, annealing at 57?C for 1 min 30 s, and extension at 72?C for 30 s. A final extension cycle at 60?C for 30 min followed. DNA was amplified in an Eppendorf Gradient thermocycler (Brinkmann Instruments, Inc., Westbury, NY) or an MJ Research Tetrad thermocycler (MJ Research Inc., Watertown, MA). The success of the PCR reaction was verified by agarose (2%) gel electrophoresis prior to capillary electrophoresis using the CEQ 8000 (Beckman Coulter Inc., Fullerton, CA).

Scoring Method
Allele sizing and visualization were performed using the fragment analysis module of the CEQ 8000 software. Alleles were scored by fitting peaks into bins less than 1 nucleotide.

Number of Observed Alleles
4

Size of Alleles
95-111