View | Download this marker

Marker details for CH02D12

Crop Name PEAR
Site National Clonal Germplasm Repository
Primers Forward: 5' AACCAGATTTGCTTGCCATC Reverse: 3' GCTGGTGGTAAACGTGGTG
Range Products 175-205
Polymorphic Type MICROSATELLITE

Citation(s)
  • Liebhard, R., L. Gianfranceschi, B. Koller, C. D. Ryder, R. Tarchini, E. van de Weg, & C. Gessler. 2002. Development and characterization of 140 new microsatellites in apple (Malus xdomestica Borkh.). Molec. Breed. 10:217-241.
  • Liebhard, R., M. Kellerhals, W. Pfammatter, M. Jertmini, & C. Gessler. 2003. Mapping quantitative physiological traits in apple (Malus xdomestica Borkh.). Pl. Molec. Biol. 52:511-526.

Assay details for evaluation WILDPEAR2006
Evaluation Method
Leaf samples were collected from wild Pyrus communis trees at the Corvallis repository. DNA was extracted in Corvallis, and then sent to NCGRP for SSR analyses. Results have been published.

Assay Method
DNA extracted in duplicate from young leaf tissue using PUREGENEkit (Gentra Systems). Forward primers labeled with IRD700 or IRD800 were obtained from MWG Biotech (High Point, N.C.). Unlabeled reverse primers were purchased from Integrated Technologies (Coralville, Iowa). PCR in 15 ul total volume with 10-50 ng DNA template and 0.3 to 0.7 pM of primers combined with 1.5 unites Taq Polymerase (Promega, Madison, Wis.), 1x Promega magnesium free buffer, 0.25 mM MgCl2, adn 0.25 mM dNTP (Promega). PCR amplifications were carried out using a PTC200 thermocycler (MJ Research, Reno, Nev.). The PCR proram had an initial denaturation step of 2 min at 95C followed by 30 cycles of 30 s at 95C, 30 s at 58C, 15 s at 72 C adn ending with a final extension step of 2 min at 72C. PCR rxn were diluted 1:1 in 95% formamide, 50 mM EDTA bromophenol blue loading dye, adn denatured at 95C for 3 min. Gels (6.5% LI-COR KB Plus acrylamide) were run in 1X TBE (89 mM Tris, 89 mM boric acid, 20 mM EDTA) buffer for 1 hr 45 min at 1500 V, 40 W, 40 mA and 45 C on a LI-COR 4200 DNA Sequencer.

Scoring Method
Digital images were collected using LI-COR Saga Generation2 software and were manually analyzed usign the Saga software. Alleles from replicate samples were examined at each locus and when alleles for replicates were not identical, data for that locus were entered as missing.

Control Value
PI 590184:195,199; PI 588853:199,227; PI 588850:191,199

Number of Observed Alleles
2