View | Download this marker

Marker details for CAT-B107

Crop Name HAZELNUT
Site National Clonal Germplasm Repository
Repeat Motif (CT)14
Primers Forward: NED-GTAGGTGCACTTGATGTGCTTTAC Reverse: AACACCATATTGAGTCTTTCAAAGC
Assay Conditions DNA was extracted from fresh hazelnut leaves according to Lunde et al. (2000). Forward primers for the 21 SSRs were fluorescently labeled with FAM, HEX or NED. Polymerase chain reactions (PCRs) were performed in a total volume of 10 �l. The reaction mixture contained 1X Biolase NH4 reaction buffer, 2 mM MgCl2, 200 �M each of dATP, dCTP, dGTP, and dTTP, 0.3 �M each of forward and reverse primers, 0.25 units of Biolase DNA polymerase (Bioline Inc., Randolph, MA), and 2.5 ng of template DNA. The PCR program consisted of 35 cycles of a 40 s denaturation step at 94 �C, a 40 s annealing step at the optimum annealing temperature, and a 40 s extension step at 72 �C. There was a final 30 min extension step at 72 �C to maximize non-templated adenosine addition to the 5' ends. PCRs were carried out in Perkin-Elmer model 9700 thermocyclers (Applied Biosystems, Foster City, CA). Amplification and approximate fragment sizes were confirmed by agarose (3%) gel electrophoresis. Amplified PCR products were diluted multiplexed and separated on an ABI 3100 capillary electrophoresis instrument at the Central Services Laboratory (CSL) of the Center for Genome Research and Biocomputing (CGRB) at OSU. DNA fragment sizes were determined using GeneScan and Genotyper software.
Range Products 112-151
Genbank Number DQ090008
Map location 10
Polymorphic Type MICROSATELLITE
Comment SSR- CAT-B107 was obtained from microsatellite enrichment for the GA motif of genomic library B of hazelnut (Genetic Identification Services, Chatsworth, California); Linkage Group: 10R

Citation(s)
  • Study of: CORYLUS.CORVALLIS.GOKIRMAK.GRCE.2009. Acta Hort.

Assay details for evaluation CULTIVATED.HAZELNUT.SSR.2005
Evaluation Method
DNA Extraction

DNA was extracted according to Lunde et al. (2000) with minor modifications: RNA was removed by incubation with RNase A (Sigma, St. Louis, MO) at 37 C for one hour followed by extraction with phenol: chloroform: isoamyl alcohol (25:24:1). The DNA concentrations were determined spectrophotometrically and adjusted to 5 ng/ul.

PCR Protocol

PCR reactions were performed in 10 mL volume containing 1X reaction buffer, 2 mM MgCl2, 0.2 mM dNTPs, 0.3 uM of each primer, 0.25 units of Biolase Taq DNA polymerase (Bioline Inc.), and 2.5 ng genomic DNA.

After initial denaturation at 94 C for 3 minutes, DNA was amplified for 35 cycles in Perkin-Elmer model 9700 thermocyclers (PE Applied Biosystems, Foster City, CA) programmed for a 40 s denaturation step at 94 C, a 40 s at optimum annealing temperature, and a 40 s extension step at 72 C. A final extension step of 72 C for 30 minutes followed.

View a table of the SSR data as an Excel Spreadsheet.


Assay Method
DNA was extracted according to Lunde et al. (2000) with minor modifications: RNA was removed by incubation with RNase A (Sigma, St. Louis, MO) at 37 C for one hour followed by extraction with phenol: chloroform: isoamyl alcohol (25:24:1). The DNA concentrations were determined spectrophotometrically and adjusted to 5 ng/ul. PCR reactions were performed in 10 �L volume containing 1X reaction buffer, 2 mM MgCl2, 0.2 mM dNTPs, 0.3 �M of each primer, 0.25 units of Biolase Taq DNA polymerase (Bioline Inc.), and 2.5 ng genomic DNA. After initial denaturation at 94 C for 3 min, DNA was amplified for 35 cycles in Perkin-Elmer model 9700 thermocyclers (PE Applied Biosystems, Foster City, CA) programmed for a 40 s denaturation step at 94 �C, a 40 s at optimum annealing temperature of 58 C, and a 40 s extension step at 72 C. A final extension step of 72 C for 30 min followed. Separation: ABI3100 Capillary Electrophoresis.

Number of Observed Alleles
2

Size of Alleles
112-151


Assay details for evaluation CORYLUS.CORVALLIS.GOKIRMAK.GRCE.2009
Evaluation Method
The European hazelnut, Corylus avellana L., is the species of commerce and has been used as a food source by humans since prehistoric times. The objective of this study was to use 21 SSR loci to evaluate genetic diversity in 270 accessions of European hazelnut representing a wide geographic range from the USDA-ARS NCGR National collection and from the OSU hazelnut breeding collection. We also wanted to validate suspected duplicates, and investigate the parentage of some accessions. Of the 270 accessions, 198 had unique fingerprints while 72 were duplicates, as suspected based on identical morphology and incompatibility alleles. SSR alleles indicate the parentage of 31 accessions. The identification of duplicate and mislabeled accessions will improve management of the hazelnut germplasm collection. The results of this study were published in Genetic Resources and Crop Evolution 56(2): 147-172.

Assay Method
DNA was extracted from fresh hazelnut leaves according to Lunde et al. (2000). Forward primers for the 21 SSRs were fluorescently labeled with FAM, HEX or NED. Polymerase chain reactions (PCRs) were performed in a total volume of 10 �l. The reaction mixture contained 1X Biolase NH4 reaction buffer, 2 mM MgCl2, 200 �M each of dATP, dCTP, dGTP, and dTTP, 0.3 �M each of forward and reverse primers, 0.25 units of Biolase DNA polymerase (Bioline Inc., Randolph, MA), and 2.5 ng of template DNA. The PCR program consisted of 35 cycles of a 40 s denaturation step at 94 �C, a 40 s annealing step at the optimum annealing temperature, and a 40 s extension step at 72 �C. There was a final 30 min extension step at 72 �C to maximize non-templated adenosine addition to the 5' ends. PCRs were carried out in Perkin-Elmer model 9700 thermocyclers (Applied Biosystems, Foster City, CA). Amplification and approximate fragment sizes were confirmed by agarose (3%) gel electrophoresis. Amplified PCR products were diluted multiplexed and separated on an ABI 3100 capillary electrophoresis instrument at the Central Services Laboratory (CSL) of the Center for Genome Research and Biocomputing (CGRB) at OSU.

Scoring Method
DNA fragment sizes were determined using GeneScan and Genotyper software.

Number of Observed Alleles
15

Size of Alleles
112-151