View | Download this marker

Marker details for CAC-C010

Crop Name HAZELNUT
Site National Clonal Germplasm Repository
Repeat Motif (GAA)7GGA(GAA)2N21(GAA)2ATT(GAA)4N15(GAA)3
Primers Forward: NED-GGAGCCACCATGAAATTATACA Reverse: CACTTATTGCGATTGGTTCA
Assay Conditions Optimum Annealing Temperature: 58 C; Separation: ABI3100 Capillary Electrophoresis
Range Products 272-319
Genbank Number DQ151605
Polymorphic Type MICROSATELLITE
Comment SSR-CAC-C010 was obtained from microsatellite enrichment for the AAG motif of genomic library C of hazelnut (Genetic Identification Services, Chatsworth, California); Linkage Group: N/A

Citation(s)

Assay details for evaluation CULTIVATED.HAZELNUT.SSR.2005
Evaluation Method
DNA Extraction

DNA was extracted according to Lunde et al. (2000) with minor modifications: RNA was removed by incubation with RNase A (Sigma, St. Louis, MO) at 37 C for one hour followed by extraction with phenol: chloroform: isoamyl alcohol (25:24:1). The DNA concentrations were determined spectrophotometrically and adjusted to 5 ng/ul.

PCR Protocol

PCR reactions were performed in 10 mL volume containing 1X reaction buffer, 2 mM MgCl2, 0.2 mM dNTPs, 0.3 uM of each primer, 0.25 units of Biolase Taq DNA polymerase (Bioline Inc.), and 2.5 ng genomic DNA.

After initial denaturation at 94 C for 3 minutes, DNA was amplified for 35 cycles in Perkin-Elmer model 9700 thermocyclers (PE Applied Biosystems, Foster City, CA) programmed for a 40 s denaturation step at 94 C, a 40 s at optimum annealing temperature, and a 40 s extension step at 72 C. A final extension step of 72 C for 30 minutes followed.

View a table of the SSR data as an Excel Spreadsheet.


Assay Method
DNA was extracted according to Lunde et al. (2000) with minor modifications: RNA was removed by incubation with RNase A (Sigma, St. Louis, MO) at 37 C for one hour followed by extraction with phenol: chloroform: isoamyl alcohol (25:24:1). The DNA concentrations were determined spectrophotometrically and adjusted to 5 ng/ml. PCR reactions were performed in 10 �L volume containing 1X reaction buffer, 2 mM MgCl2, 0.2 mM dNTPs, 0.3 �M of each primer, 0.25 units of Biolase Taq DNA polymerase (Bioline Inc.), and 2.5 ng genomic DNA. After initial denaturation at 94 C for 3 min, DNA was amplified for 35 cycles in Perkin-Elmer model 9700 thermocyclers (PE Applied Biosystems, Foster City, CA) programmed for a 40 s denaturation step at 94 C, a 40 s at optimum annealing temperature of 58 C, and a 40 s extension step at 72 C. A final extension step of 72 C for 30 min followed. Separation: ABI3100 Capillary Electrophoresis.

Number of Observed Alleles
2

Size of Alleles
272-319