View | Download this marker

Marker details for HLC-001D

Crop Name HOPS
Site National Clonal Germplasm Repository
Repeat Motif (CT)6, (TA)6
Primers Forward: CATGATTGGTCAAAACAAGTGG Reverse: GGATCGTTGAGAAGCTCTGATT
Assay Conditions Optimum Annealing Temperature: 60 C; Separation: ABI 3100 Capillary Electrophoresis; Dye: FAM (Operon)
Range Products 238-272 bp
Genbank Number 13537420 (AB053486)
Position 5'UTR
Polymorphic Type MICROSATELLITE

Citation(s)

Assay details for evaluation EUROPEAN.NORTH.AMERICAN.HUMULUS.SSR.2007
Evaluation Method
DNA Extraction: DNA was extracted from actively growing young leaves in the spring, by using a modified Puregene (Gentra Systems Inc., Minneapolis, MN) extraction protocol. Proteinase K and RNase A digestion steps were included in the extraction and protein precipitation was repeated twice.

Microsatellite Primers: The locus name is 'HL' for Humulus lupulus, 'C' for Corvallis, followed by a three-digit number and alphabetical letters when more than one microsatellite was present in the same sequence. Eight EST-SSRs were used in this study and they include HLC-001A, HLC-001D, HLC-002B, HLC-003A, HLC-004B, HLC-005B, HLC-006, and HLC-007.

PCR Reaction: PCR reactions were carried out separately for each primer pair by using a fluorescently labeled forward primer (FAM, HEX, or NED) and an unlabeled reverse primer. The reactions were performed in 10 uL volumes containing 1X reaction buffer, 2 mM MgCl2, 0.2 mM dNTPs, 0.3 uM of each primer, 0.25 units of Biolase Taq DNA polymerase (Bioline USA Inc., Randolph, MA), and 2.5 ng genomic DNA. After initial denaturation at 94 C for 3 min, DNA was amplified for 35 cycles in an Eppendorf Gradient thermocycler (Brinkmann Instruments Inc., Westbury, NY) or an MJ Research Tetrad thermocycler (MJ Research, Inc., Watertown, MA) programmed for 40 s at 94 C, 40 s annealing at the optimum annealing temperature of the primer pair, and 40 s extension at 72 C. Amplification was followed by a final extension at 72 C for 30 min.

Microsatellite Marker Detection: Up to three PCR products were included in each multiplex, and the final dilution factor ranged from 1:80 to 1:320. The size of the SSR amplicons was determined after separation on an ABI 3100 capillary (Applied Biosystems, Foster City, CA) sequencer at the Oregon State University's Center for Genome Research and Biocomputing (Corvallis, OR). GeneScan (version 2.1) was used for automated data collection. Genotyper (version 2.0) was used for computation of allele sizes and accurate visualization of these alleles.


Assay Method
DNA was extracted from actively growing young leaves in the spring, by using a modified Puregene (Gentra Systems Inc., Minneapolis, MN) extraction protocol. Proteinase K and RNase A digestion steps were included in the extraction and protein precipitation was repeated twice. PCR reactions were carried out with a FAM (Operon)-labeled forward primer and an unlabeled reverse primer. The reactions were performed in 10 uL volumes containing 1X reaction buffer, 2 mM MgCl2, 0.2 mM dNTPs, 0.3 uM of each primer, 0.25 units of Biolase Taq DNA polymerase (Bioline USA Inc., Randolph, MA), and 2.5 ng genomic DNA. After initial denaturation at 94 C for 3 min, DNA were amplified for 35 cycles in an Eppendorf Gradient thermocycler (Brinkmann Instruments Inc., Westbury, NY) or an MJ Research Tetrad thermocycler (MJ Research, Inc., Watertown, MA) programmed for 40 s at 94 C, 40 s annealing at the optimum annealing temperature of the primer pair, and 40 s extension at 72 C. Amplification was followed by a final extension at 72 C for 30 min.

Scoring Method
Up to three PCR products were included in each multiplex, and the final dilution factor ranged from 1:80 to 1:320. The size of the SSR amplicons was determined after separation on an ABI 3100 capillary (Applied Biosystems, Foster City, CA) sequencer at the Central Services Laboratory of Oregon State University (Corvallis, OR). GeneScan (version 2.1) was used for automated data collection. Genotyper (version 2.0) was used for computation of allele sizes and accurate visualization of these alleles.

Number of Observed Alleles
2

Size of Alleles
238-272 bp