View | Download this marker

Marker details for MIR159A_SA4_700_6

Crop Name CHICKPEA
Site Western Regional PI Station
Primers Forward: GATCCTTGGTTCTTTGG Reverse: TTACCTTGGTCATACAACATT
Assay Conditions Genomic DNA was isolated using the DNeasy Plant DNA isolation kit (Qiagen, Valencia, CA) according to manufacturer guidelines.
Polymorphic Type TRAP

Citation(s)

Assay details for evaluation CHICKPEA.CSP.2011.TRAP
Evaluation Method
Our TRAP protocol followed that of Hu and Vick (2003) and used three fixed and four arbitrary primers (Table 1). Four arbitrary primers and one fixed primer used in the current study are based on those described by Hu et al. (2005). The other two fixed primers (prefix, MIR) were designed against micro RNA sequences in Arabidopsis thaliana (L.) Heynh. (Kwon et al. 2010). Four sets of PCR with 8 primer combinations were run with all the DNA samples (Table 2). TRAP amplification was carried out according to Hu et al.?s (2007) protocol. A total volume of 10 ?l was used for PCR amplification, which contained 1?l of genomic DNA (10 ng /?l), 0.2 ?l of the fixed primer (10 pmol / ?l), 0.2 ?l each of 700- & 800-IR dye labeled arbitrary primers (1 pmol / ?l), 0.8 ?l of dNTP (2.5 mM), 0.3?l of MgCl2 (50 mM), 1.0 ?l of 10 ? PCR buffer, 0.2 ?l of Taq polymerase (5 unit/?l; Bioline, Taunton, MA, USA), and 6.3 ?l water. PCR was performed by initially denaturing template DNA at 940C (2 minutes) followed by 5 cycles at 940C (45 second), 400C (45 second) and 720C (60 second), then 35 cycles at 940C (45 second), 500C (45 second) and 720C (60 second) and final extension at 720C (7 minutes). PCR was carried out in GenAmp 9700 thermal cyclers (Applied Biosystem, Foster City, CAalifornia, USA). Amplified products were separated on a 6.5% polyacrylamide sequencing gel in a Li-Cor Global DNA Sequencer (Li-Cor Biosciences, Lincoln, Nebraska, USA) by electrophoresis at 1500 V for 3 hours. The images were collected and scored manually.

For a Excel(xlsx) file of the Cicer TRAP data.

For a PDF file of the Cicer TRAP publication.