View | Download this marker

Marker details for MTCCIR18

Crop Name CACAO
Site Tropical Agriculture Research Station
Repeat Motif (GA)12
Primers Forward: 5' GATAGCTAAGGGGATTGAGGA Reverse: 3' GGTAATTCAATCATTTGAGGATA
Genbank Number Y16991
Polymorphic Type MICROSATELLITE

Citation(s)

Assay details for evaluation CACAOSSR2007
Evaluation Method
Fifteen microsatelite markers were used to fingerprint all 154 accessions of the current USDA-ARS TARS cacao germplasm collection. Fingerprint profiles generated were used to determine inter-clonal and intra-clonal error, as well as identifying potential genetic gaps and estimating genetic diversity among current accessions. A Fast DNA SPIN Kit (MP Biomedicals, Irvine, CA) was utilized for DNA extraction using the procedure described in the manual with minor modifications. Forward primers were labeled with one of three fluorescent dyes on the 5' end and all 15 primer pairs were used on all individuals for the analysis in a 10 ul reaction. Capillary electrophoresis was performed on an ABI Prism 3730 Genetic Analyzer. Electrophoresis results were analyzed with GeneMapper 3.0 software to determine alleles and for internal standard and fragment size determination.

Assay Method
Five leaves from each plant (6 plants total) were collected and frozen at 20oC. A Fast DNA' SPIN Kit (MP Biomedicals, Irvine, CA) was utilized for DNA extraction and followed the procedure described in the manual. Fifteen microsatellite primers combinations were used in this study. All primers were originally designed and produced at the Centre de Cooperation Internationale en Recherche Agronomique pour le Developpement (CIRAD) Montpellier, France. Forward primers were labeled with one of three fluorescent dyes (Applied Biosystems; Foster City, CA) on the 5' end and all 15 primer pairs were used on all individuals for the analysis in a 10 ul reaction. PCR reactions included 1.0 ul 10X PCR buffer (New England Biolabs, Ipswich, MA), 1.0 ul BSA (New England Biolabs, Ipswich, MA) 0.2 ul dNTP's (10mM each) (Promega, Madison, WI), 0.5 ul forward and 0.5 ul reverse primers, 0.05 ul Taq Polymerse (New England Biolabs, Ipswich, MA), adjusted with 4.75 ul ddH2O and 2.0 ul template DNA. PCR amplification reactions were performed on a DNA Engine tetrad thermalcycler (MJ Research, Inc.; Watertown, MA) with the following conditions, 94oC for 4 min, 32 cycles of 94oC for 30 sec, 46 or 51oC fir 60 s, 72oC s, with a final extension at 72oC for 7 min, soak 4oC. Capillary electrophoresis was performed on an ABI Prism 3730 Genetic Analyzer (Applied Biosystems; Foster City, CA) using Performance Optimized Polymer 7 (POP 7; Applied Biosystems; Foster City, CA). Samples were prepared immediately prior to electrophoresis by adding 1.0 ul of PCR product to 20.0 ul of deionized water and 0.05 ul of GeneSacan 500 Rox size standard (Applied Biosystems; Foster City, CA), then denatured at 95oC for 2 min, and chilled on ice. Samples were injected electrokinetically at 2 kV for 10 s and were run at 15 kV and 60oC for 16 min.

Scoring Method
Electrophoresis results were analyzed with GeneMapper 3.0 software (Applied Biosystems; Foster City, CA) to determine alleles and for internal standard and fragment size determination.

Number of Observed Alleles
9

Size of Alleles
331-355