View | Download this marker

Marker details for MMACIR03

Crop Name MUSA
Site Tropical Agriculture Research Station
Repeat Motif (GA)10
Primers Forward: 5' TGACCCACGAGAAAAGAAGC Reverse: 3' CTCCTCCATAGCCTGACTGC
Genbank Number X87263
Polymorphic Type MICROSATELLITE

Citation(s)

Assay details for evaluation MUSASSR2012
Evaluation Method
Plant material for DNA extractions was collected from three separate Musa spp. field plantings on the TARS research farm in Isabela, PR as well as from the tissue culture collection. Leaf samples were collected from all four replicate plants in the established field germplasm collection, from representative plants from a Sigatoka leaf spot disease evaluation plot as well as from a core set of Musa spp. plants being evaluate for morphological traits. As plants in the in vitro tissue culture are micro-propagated from one initial initiated apical meristem, a single representative plantlet for each accession was used for DNA extraction. Additional DNA samples were graciously provided by Dr. Jaroslav Dolezel, on a cost recovery basis and as part of the GMGC service from the Laboratory of Molecular Cytogenetics and Cytometry of the Institute of experimental Botany, Prage, Czech Republic. These reference DNA sample duplicates were included in the analysis as references for specific subgroups not represented in the existing collection as well as a separate source of DNA to confirm matching with synonymous clones and reproducibility as of technique. DNA samples were then shipped to USDA-ARS Genomics and Bioinformatics Research Unit in Stoneville, MS for PCR and subsequent electrophoresis. Twenty two microsatellite makers were used to fingerprint replicated plants for 184 unique accessions of the current USDA-ARS TARS Musa spp. germplasm collection. SSR primer sequences were developed (Crouch et al. 1998; Lagoda et al. 1998; Hippolyte et al. 2010) and selected for their allelic diversity and for usefulness in distinguishing diverse Musa spp.

Assay Method
Single leaf samples for each plant (5 plants total) were collected and extracted using a Fast DNA(R) SPIN Kit (MP Biomedicals, Irvine, CA). Twenty two microsatellite primers combinations were used in this study. Primers were fluorescently labeled with HEX or FAM, and PCR reactions were carried out using 10-ng DNA and Titanium Taq DNA Polymerase (Clontech, Mountain View, CA) in a 5ml reaction. Each reaction contained 10-ng of DNA template, 0.1ul each of 10pmol/ul forward and reverse primer (fluorescently labeled with either HEX or FAM), 0.5ul Titanium Taq PCR Buffer, 0.1 mL 50X Titanium Taq Polymerase, 0.04ul of 25mM dNTP mix, and water to equal 5ul. PCR amplification was performed at 95 �C for 1 minute; 30 cycles of 95 �C for 30 seconds, 55 �C for 30 seconds, and 68 �C for 30 seconds; and a final extension at 68 �C for 3 minutes.

Scoring Method
Following amplification, PCR reactions were poolplexed according to fragment size and dye color and run on a 3730XL DNA Analyzer.� Allele calls were performed using GeneMapper 3.7 software (Applied Biosystems, Foster City, CA) to determine alleles as well as for internal standard and fragment size determination.

Number of Observed Alleles
10

Size of Alleles
90-113