View | Download this marker

Marker details for GD142

Crop Name APPLE
Site Natl. Germplasm Repository - Geneva
Repeat Motif (TC)19
Primers Forward: 5' GGCACCCAAGCCCCTAA Reverse: 3' GGAACCTACGACAGCAAAGTTACA
Assay Conditions Extract DNA from leaves, PCR amplify in Perkin Elmer 9600 thermocycler. Multiplexed primer set of GD142, GD147 adn GD162 was PCR amplified in a 20 ul reaction mixture containing 30 ng of genomic template dNA, 20 pmols of each primer pair, 0.20 mM of dNTPs, 2.0 mM MgSO4, 1x ThermoPol reaction buffer, and 0.20 units of Deep Vent polymerase (New England Biolabs). Multiplex primer set GD142, GD147, and GD162 was amplified using a touchdown amplification program. DNA was denatured for 2 min at 94C, followed by 2 cycles of 94C for 60 s, 65C primer annealing for 30 s, and 72oC primer elongation for 45 sec. The following 18 cycles had an annealing temperature reduced by 1C per 2 cycles. The last 5 cycles maintained the 55C annealing temperature. Amplified products were electrophoresed on an ABI 377 or 272 DNA sequencing system. Golden Delicious was used as the control. Automated sizing of fragements was determined using ABI Genescan 672 sofware ver. 1.2.2-1. relative to an internal lane standard, GEnescan 350 Tamara which was loaded with the amplification products in each lane at the beginning of the run.
Range Products 123-158
Polymorphic Type MICROSATELLITE

Citation(s)
  • Hokanson, S. C., A. K. Szewc-McFadden, W. F. Lamboy, & J. R. McFerson. 1998. Microsatellite (SSR) markers reveal genetic identities, genetic diversity and relationships in a Malus x domestica borkh. core subset collection. Theor. Appl. Genet. 97:671-683.

Assay details for evaluation 2005MALUSSIEVERSIISITES6AND9
Evaluation Method
Phil Forsline and his collaborators brought back Malus sieversii seeds and clones from several collection sites in Kazakhstan in 1995 and 1996. These analyses compare the genetic diversity of 274 M.sieversii individuals from collection site 9 and 174 individuals of M. sieversii from collection site 6. The purpose of the study was to compare allelic diversity with phenotypic diversity and identify core subsets of individuals that capture much of the characterized diversity from these 2 collection sites. This paper has been published (see Evaluation citation).

Assay Method
Leaves of 2 samples of each individual were extracted using DNeasy 96 plant kits (Qiagen). Malus SSRs were amplified with forward primers labeled with either IRD 700 or IRD800 obtained from MWG-Biotech. Unlabeled reverse primers were purchased from IDT (Coralville, Iowa). PCR was carried out in 15 uL total volume. 10-50 ng DNA template and primers (0.3 pM) were combined with 1.5 units Taq polymerase (Promega), 1x Promega Magnesium free buffer (10 mM Tris-HCl, 50 mM KCl, and 0.1% Triton X-100), 0.25 mM MgCl2, adn 0.25 mM dNTP. PCR amplifications were carried out using MJ Research PTC200 or Dyad Thermocyclers. A touch-down program reduced the annealing temperature 2 C every other cycle starting at 63C and ending at 57C, followed by an annealing temperature of 55C for 20 additional cycles, and ended with a 2 min 72C extension. Completed PCR reactins were diluted 1:1 in 95% formamide, 50 mM EDTA, bormophenol blue loading dye, and denatured at 95C for 3 min. Gels (6.5% LI-COR KB Plus acrylamide) were run in 1x TBE (89 mM Tris, 89 mM boric acid, 20 mM EDTA) buffer for 1 h 45 min at 1500 V, 40 W, 40 mA, and 45C on a LI-COR 4200 DNA sequencer.

Scoring Method
Digital images were collected from the sequencer using LI-COR Saga Generation 2 software and were manually analyzed using the Saga software. Alleles from replicate samples were examined at each locus and when alleles for replicates were not identical, data for that locus were entered as missing in subsequent analyses.

Control Value
PI 590184:142,142; PI 588853:140,142; PI 588850:134,140


Assay details for evaluation 2007MALUSORINETALISRUSSIATURKEY
Evaluation Method
Seven microsatellites were used to analyze genetic diversity of 496 Malus orientalis accessions grown from seeds collected in Russia (1998) and Turkey (1999). Results have been published (Volk et al., (2008) J. Am. Soc.Hort. Sci.

Assay Method
Leaves of 2 samples of each individual were extracted using DNeasy 96 plant kits (Qiagen). Malus SSRs were amplified with forward primers labeled with either IRD 700 or IRD800 obtained from MWG-Biotech. Unlabeled reverse primers were purchased from IDT (Coralville, Iowa). PCR was carried out in 15 uL total volume. 10-50 ng DNA template and primers (0.5 pM) were combined with 1.5 units Taq polymerase (Promega), 1x Promega Magnesium free buffer (10 mM Tris-HCl, 50 mM KCl, and 0.1% Triton X-100), 0.25 mM MgCl2, adn 0.25 mM dNTP. PCR amplifications were carried out using MJ Research PTC200 or Dyad Thermocyclers. A touch-down program reduced the annealing temperature 2 C every other cycle starting at 63C and ending at 57C, followed by an annealing temperature of 55C for 20 additional cycles, and ended with a 2 min 72C extension. Completed PCR reactins were diluted 1:1 in 95% formamide, 50 mM EDTA, bormophenol blue loading dye, and denatured at 95C for 3 min. Gels (6.5% LI-COR KB Plus acrylamide) were run in 1x TBE (89 mM Tris, 89 mM boric acid, 20 mM EDTA) buffer for 1 h 45 min at 1500 V, 40 W, 40 mA, and 45C on a LI-COR 4200 DNA sequencer.

Scoring Method
Digital images were collceted from the sequencer using LI-COR Saga Generation 2 software and were manually analyzed using the Saga software. Alleles from replicate samples were examined at each locus and when alleles for replicates were not identical, data for that locus were entered as missing in subsequent analyses.

Control Value
PI 588853 (Coxs Orange Pippin):140,142; PI 590184 (Golden Delicious):142,142; PI 588850 (Rome Beauty Law):134,140

Number of Observed Alleles
2