View | Download this marker

Marker details for NA41

Crop Name VACCINIUM
Site National Clonal Germplasm Repository
Repeat Motif (CT)10...(CT)7
Primers Forward: TTCCTTTAGTCGCGTCATCA Reverse: GTTTAAGGTCGCTACGAGACTCCA
Assay Conditions Optimum Annealing Temperature: 62 C; Separation: Beckman CEQ 8000 Capillary Electrophoresis; Dye: Light Sabre Green (Synthegen)
Range Products 186-242
Genbank Number CF811380
Position 5' UTR
Polymorphic Type MICROSATELLITE
Comment SSR-NA41 was obtained from Jeannie Rowland's EST library of non-cold-acclimated 'Bluecrop' flower buds. BLAST Hit: Phantastica mRNA/ transcription factor (AY559043). BLAST Value: 6.00E-53.

Citation(s)

Assay details for evaluation VACCINIUM.CULTIVATED.BLUEBERRY.SSR.2005
Evaluation Method
DNA Extraction

DNA was extracted from young leaves with the PureGene kit (Gentra).

PCR Protocol

PCR reactions were performed in 10 uL volume containing 1X reaction buffer, 2 mM MgCl2, 0.2 mM dNTPs, 0.15 uM of each primer (if separation platform consisted of CEQ 8000) or 0.3 uM of each primer (if separation platform consisted of ABI 3100), 0.25 units of Biolase Taq DNA polymerase (Bioline Inc.), and 2.5 ng genomic DNA.

After initial denaturation at 94 C for 3 minutes, DNA was amplified for 35 cycles in an Eppendorf Gradient thermocycler or an MJ Research Tetrad thermocycler programmed for a 40 s denaturation step at 94 C, a 40 s at optimum annealing temperature, and a 40 s extension step at 72 C. A final extension step of 72 C for 30 minutes followed.

View a table of the SSR data as an Excel Spreadsheet.


Assay Method
DNA was extracted from young leaves with the PureGene kit (Gentra). PCR reactions were performed in 10 uL volume containing 1X reaction buffer, 2 mM MgCl2, 0.2 mM dNTPs, 0.15 uM of each primer, 0.25 units of Biolase Taq DNA polymerase (Bioline Inc.), and 2.5 ng genomic DNA. After initial denaturation at 94 C for 3 min, DNA was amplified for 35 cycles in an Eppendorf Gradient thermocycler or an MJ Research Tetrad thermocycler programmed for a 40 s denaturation step at 94 C, a 40 s at optimum annealing temperature, and a 40 s extension step at 72 C. A final extension step of 72 C for 30 min followed.

Scoring Method
The size of the SSR amplicons were determined after separation on a Beckman CEQ 8000 genetic analyzer. PCR products were injected from a 26 uL volume of Sample Loading Solution (Beckman Coulter Inc., Fullerton, CA) containing 0.4-0.6 uL of CEQ-600 size standard and 0.05-2 uL of undiluted PCR product. Up to 3 primer pairs were multiplexed post-PCR. Allele sizing and visualization were performed using the fragment analysis module of the CEQ 8000 software.

Number of Observed Alleles
4

Size of Alleles
186-242 bp