View | Download this marker

Marker details for NA398

Crop Name VACCINIUM
Site National Clonal Germplasm Repository
Repeat Motif (AAAT)5
Primers F: TCCTTGCTCCAGTCCTATGC R: GTTTCCTTCCACTCCAAGATGC
Assay Conditions Optimum Annealing Temperature: 56 C; Separation: ABI 3100 Capillary Electrophoresis; Dye: Ned (Applied Biosystems)
Range Products 211-232
Genbank Number CF811369
Polymorphic Type MICROSATELLITE
Comment SSR-NA398 was obtained from Jeannie Rowland's EST library of non-cold-acclimated 'Bluecrop' flower buds. BLAST Hit: None. BLAST Value: None.

Citation(s)

Assay details for evaluation VACCINIUM.CULTIVATED.BLUEBERRY.SSR.2005
Evaluation Method
DNA Extraction

DNA was extracted from young leaves with the PureGene kit (Gentra).

PCR Protocol

PCR reactions were performed in 10 uL volume containing 1X reaction buffer, 2 mM MgCl2, 0.2 mM dNTPs, 0.15 uM of each primer (if separation platform consisted of CEQ 8000) or 0.3 uM of each primer (if separation platform consisted of ABI 3100), 0.25 units of Biolase Taq DNA polymerase (Bioline Inc.), and 2.5 ng genomic DNA.

After initial denaturation at 94 C for 3 minutes, DNA was amplified for 35 cycles in an Eppendorf Gradient thermocycler or an MJ Research Tetrad thermocycler programmed for a 40 s denaturation step at 94 C, a 40 s at optimum annealing temperature, and a 40 s extension step at 72 C. A final extension step of 72 C for 30 minutes followed.

View a table of the SSR data as an Excel Spreadsheet.


Assay Method
DNA was extracted from young leaves with the PureGene kit (Gentra). PCR reactions were performed in 10 uL volume containing 1X reaction buffer, 2 mM MgCl2, 0.2 mM dNTPs, 0.3 uM of each primer, 0.25 units of Biolase Taq DNA polymerase (Bioline Inc.), and 2.5 ng genomic DNA. After initial denaturation at 94 C for 3 min, DNA was amplified for 35 cycles in an Eppendorf Gradient thermocycler or an MJ Research Tetrad thermocycler programmed for a 40 s denaturation step at 94 C, a 40 s at optimum annealing temperature, and a 40 s extension step at 72 C. A final extension step of 72 C for 30 min followed.

Scoring Method
1 ul of a mix of three or four PCR products was separated on an ABI 3100 capillary electrophoresis instrument (Applied Biosystems, Foster City, California) at the Central Services Laboratory (CSL) of the Center for Genome Research and Biocomputing (CGRB) at Oregon State University (OSU). DNA fragment sizes were determined using GeneScan and Genotyper software.

Number of Observed Alleles
4

Size of Alleles
211-232 bp


Assay details for evaluation 2019 10-SSR Blueberry
Evaluation Method
Leaves were collected from 299 actively growing plants representing 143 accessions that are preserved in greenhouses, screenhouses, or field collections at the USDA-ARS, NCGR, Corvallis, OR. Leaf samples were also obtained for an additional 68 plants from two nurseries (9 from N1; 11 from N2), and breeders across the US including Oregon (Chad Finn, 2, OR), Minnesota (Jim Luby, 1, MN), Mississippi (Stephen Stringer, 6, MS), North Carolina (Hamid Ashrafi, 8, NC), and New Jersey (Mark Ehlenfeldt, 28, NJ). DNA was extracted from young leaves of these 363 plants using a modified Qiagen protocol described in detail by Gilmore et al. (2011). DNA amplification with the 5-SSR or the 10-SSR multiplex was performed with the Type-it Multiplex PCR mix (Qiagen Inc., Valencia, CA, USA) as detailed by Bidani et al., 2017. DNA was amplified in an Eppendorf Gradient thermocycler (Eppendorf, Westbury, NY, USA) or an MJ Research Tetrad thermocycler (BioRad, Hercules, CA, USA). The PCR protocol consisted of a “touchdown” program with an initial denaturation cycle at 94 ºC for 3 min followed by ten cycles of 40 sec at 94 °C; 45 sec at 62 °C, decreasing 1 °C each cycle; and 45 sec at 72 °C. PCR continued for an additional 28 cycles of 40 sec at 94 °C; 45 sec at 52 °C; and 45 sec at 72 °C; followed by a final extension at 72 °C for 30 min. Once amplification success was verified by 2% agarose gel electrophoresis, PCR products were pooled and separated by capillary electrophoresis with a Beckman CEQ 8000 (Beckman Coulter, Inc.). In all cases, allele sizing and visualization were performed using the fragment analysis module of the CEQ 8000 software. Individuals were scored by grouping PCR fragment sizes (alleles) into bins of less than one base pair.