View | Download this marker

Marker details for CA169F

Crop Name VACCINIUM
Site National Clonal Germplasm Repository
Repeat Motif (GAT)4
Primers Forward: TAGTGGAGGGTTTTGCTTGG Reverse: GTTTATCGAAGCGAAGGTCAAAGA
Assay Conditions Optimum Annealing Temperature: 62 C; Separation: ABI 3100 Capillary Electrophoresis; Dye: Fam (Operon)
Range Products 109-136
Genbank Number CF811071
Polymorphic Type MICROSATELLITE
Comment SSR-CA169F was obtained from Jeannie Rowland's EST library of cold-acclimated 'Bluecrop' flower buds. BLAST Hit: None. BLAST Value: None.

Citation(s)

Assay details for evaluation VACCINIUM.CULTIVATED.BLUEBERRY.SSR.2005
Evaluation Method
DNA Extraction

DNA was extracted from young leaves with the PureGene kit (Gentra).

PCR Protocol

PCR reactions were performed in 10 uL volume containing 1X reaction buffer, 2 mM MgCl2, 0.2 mM dNTPs, 0.15 uM of each primer (if separation platform consisted of CEQ 8000) or 0.3 uM of each primer (if separation platform consisted of ABI 3100), 0.25 units of Biolase Taq DNA polymerase (Bioline Inc.), and 2.5 ng genomic DNA.

After initial denaturation at 94 C for 3 minutes, DNA was amplified for 35 cycles in an Eppendorf Gradient thermocycler or an MJ Research Tetrad thermocycler programmed for a 40 s denaturation step at 94 C, a 40 s at optimum annealing temperature, and a 40 s extension step at 72 C. A final extension step of 72 C for 30 minutes followed.

View a table of the SSR data as an Excel Spreadsheet.


Assay Method
DNA was extracted from young leaves with the PureGene kit (Gentra). PCR reactions were performed in 10 uL volume containing 1X reaction buffer, 2 mM MgCl2, 0.2 mM dNTPs, 0.3 uM of each primer, 0.25 units of Biolase Taq DNA polymerase (Bioline Inc.), and 2.5 ng genomic DNA. After initial denaturation at 94 C for 3 min, DNA was amplified for 35 cycles in an Eppendorf Gradient thermocycler or an MJ Research Tetrad thermocycler programmed for a 40 s denaturation step at 94 C, a 40 s at optimum annealing temperature, and a 40 s extension step at 72 C. A final extension step of 72 C for 30 min followed.

Scoring Method
1 ul of a mix of three or four PCR products was separated on an ABI 3100 capillary electrophoresis instrument (Applied Biosystems, Foster City, California) at the Central Services Laboratory (CSL) of the Center for Genome Research and Biocomputing (CGRB) at Oregon State University (OSU). DNA fragment sizes were determined using GeneScan and Genotyper software.

Number of Observed Alleles
4

Size of Alleles
109-136 bp