View | Download this marker

Marker details for CAC-C111

Crop Name HAZELNUT
Site National Clonal Germplasm Repository
Repeat Motif (AGG)8
Primers F: 5'ATTAGGCAACTGTCTCGTCAAC3' R: 5'GGAATTTACAGTTGGAGCTGAT3'
Assay Conditions DNA was extracted from actively growing leaves collected from the NCGR field in the spring using a modified PUREGENE® kit (Gentra Systems Inc., MN) protocol. Out of 23 SSR primer pairs developed from trinucleotide-enriched genomic library, 15 SSRs amplified in each of the 11 species evaluated in this study and were further characterized. PCR reactions were carried out separately for each primer pair and up to three PCR products (one per SSR primer set) were pooled in a multiplex and separated using capillary electrophoresis. PCR reactions were carried out in 10 μL volumes using fluorescently labeled forward primers (FAM, HEX, or NED) and unlabeled reverse primers. PCR reactions contained per 10 μL total volume 1X reaction buffer, 2 mM MgCl2, 0.2 mM dNTPs, 0.3 μM of each primer, 0.25 units of Biolase Taq DNA polymerase, and 2.5 ng genomic DNA. The PCR protocol consisted of one cycle of initial denaturation at 94 ºC for 3 min, followed by 35 cycles of denaturation at 93 ºC for 40 s, annealing at optimum Ta for 40 s, and extension at 72 ºC for 40 s. A final extension cycle at 72 ºC for 30 min followed. DNA was amplified in an Eppendorf Gradient thermocycler or an MJ Research Tetrad thermocycler. The success of the PCR reaction was verified by 2% agarose gel electrophoresis prior to capillary electrophoresis. After diluting the PCR products with water, they were separated on an ABI 3100 capillary sequencer at the Central Services Laboratory (OSU). GeneScan version 2.1 and Genotyper version 2.0 were used for automated data collection and computation of allele size and accurate visualization of the alleles, respectively.
Range Products 191-203
Polymorphic Type MICROSATELLITE

Citation(s)

Assay details for evaluation CORYLUS.CORVALLIS.BASSIL.GRCE.2011
Evaluation Method
In this study, 23 SSRs from a tri-nucleotide enriched genomic library of hazelnut were screened for amplification and polymorphism in 114 representative accessions from 11 Corylus species and 44 hybrids. Fourteen SSRs amplified a single locus and were polymorphic in all species. This study identifies SSRs that can be used for each of these species. The 14 SSRs were used to fingerprint each accession. Diversity estimates were calculated using 8 easy-to-score SSRs. Nuclear SSRs were also compared to universal chloroplast SSRs and the results of this study were submitted to Genetic Resources and Crop Evolution.

Assay Method
DNA was extracted from actively growing leaves collected from the NCGR field in the spring using a modified PUREGENE� kit (Gentra Systems Inc., MN) protocol. Out of 23 SSR primer pairs developed from trinucleotide-enriched genomic library, 15 SSRs amplified in each of the 11 species evaluated in this study and were further characterized. PCR reactions were carried out separately for each primer pair and up to three PCR products (one per SSR primer set) were pooled in a multiplex and separated using capillary electrophoresis. PCR reactions were carried out in 10 ?L volumes using fluorescently labeled forward primers (FAM, HEX, or NED) and unlabeled reverse primers. PCR reactions contained per 10 ?L total volume 1X reaction buffer, 2 mM MgCl2, 0.2 mM dNTPs, 0.3 ?M of each primer, 0.25 units of Biolase Taq DNA polymerase, and 2.5 ng genomic DNA. The PCR protocol consisted of one cycle of initial denaturation at 94 �C for 3 min, followed by 35 cycles of denaturation at 93 �C for 40 s, annealing at optimum Ta for 40 s, and extension at 72 �C for 40 s. A final extension cycle at 72 �C for 30 min followed. DNA was amplified in an Eppendorf Gradient thermocycler or an MJ Research Tetrad thermocycler. The success of the PCR reaction was verified by 2% agarose gel electrophoresis prior to capillary electrophoresis. After diluting the PCR products with water, they were separated on an ABI 3100 capillary sequencer at the Central Services Laboratory (OSU).

Scoring Method
GeneScan version 2.1 and Genotyper version 2.0 were used for automated data collection and computation of allele size and accurate visualization of the alleles, respectively. Alleles were scored by fitting the peaks into bins of less than 1 nucleotide.

Number of Observed Alleles
6

Size of Alleles
209