View | Download this marker

Marker details for RM277

Crop Name RICE
Site Rice Genetic Stock Center
Repeat Motif (GA)11
Primers Forward: 5' CGGTCAAATCATCACCTGAC Reverse: 3' CAAGGCTTGCAAGGGAAG
Assay Conditions A high-throughput method (Xin et al., 2003) was followed for collecting leaf tissue and DNA extraction. A single leaf disk from a single plant of each accession was collected in a single well of a 96-well polymerase chain reaction (PCR) plate using a single hole punch from 4-wk-old seedlings. For each accession, leaf disks were sampled from five individual plants and each disk placed in the same location in each of five 96-well plates, to assess if there were any seed mixtures. Next, each well containing a leaf disk had 70 uL of Buffer A containing 2% Tween 20 and 100 mM NaOH added. The plate was incubated at 95C for 10 min in a thermocycler with a PTC-DNA Engine (MJ Research, Waltham, MA). After incubation, 70 uL of Buffer B containing 100 mM Tris-HCl (pH 8.0) and 2 mM ethylenediaminetetraacetate (EDTA) was added to each well. This liquid solution containing DNA was suitable for PCR. For each accession, the DNA isolated from the five leaf disks in five separate 96-well plates was pooled together.
Range Products 113-122
Genbank Number AF344103
Map location 12
Position 18.29
Polymorphic Type MICROSATELLITE

Citation(s)
  • Temnykh, S., W. D. Park, N. Ayres, et al. 2000. Mapping and genome organization of microsatellite sequences in rice (Oryza sativa L.). Theor. Appl. Genet. 100:697-712.

Assay details for evaluation RICEDIVERSITY2011CROPSCI
Evaluation Method
A diverse collection of 409 Asian rice (Oryza sativa L.) accessions originating from 79 countries was fingerprinted with 36 simple sequence repeat (SSR) markers and evaluated for 18 agromorphological traits. Genetically, the accessions clustered into five ancestral groups (subpopulations), indica, aus, aromatic (Group V), tropical japonica, and temperate japonica, based on model-based structure analysis. A strong relationship between subpopulations and geographical distribution was observed. This rice diversity panel with the accompanying genetic and phenotypic information provides a valuable foundation for association mapping, understanding the basis of both genotypic and phenotypic differences within and between subpopulations, and rice improvement programs. The results of this study were published in Crop Science 51:2021-2035.

Assay Method
The polymerase chain reaction was performed in a 25-ul reaction volume that contained 20 ng of genomic DNA, 1 unit of Taq DNA polymerase, 0.1% BSA, 1% PVP40, 10mM Tris-HCl pH 8.3, 50mM KCl, 2.5mM MgCl2, 200 uM of dNTPFs, and 300nM of each primer. The forward primer was labeled with 6FAM and was purchased from DNA Technologies (IDT) (Coralville, IA). The reverse primer was unlabelled. DNA was amplified under the following conditions: (1) initial denaturation at 94C for 5 min; (2) 35 cycles of 94C for 1 min, 55C for 1 min, 72C for 2 min; (3) 5 min final extension at 72C. PCR products were pooled based on color and size range of PCR fragments (three markers per run along with the ROX labeled size standard) and heated to 94C for 5 min to denature the DNA. The samples were separated by capillary electrophoresis using an ABI Prism 3730 DNA Analyzer according to the manufacturer's instructions, and SSR fragments sizing and allele calls were performed with GeneMapper V3.7 (Applied Biosystems, Foster City, CA). The rice cultivars IR64 and Cybonnet were used as controls for the allele calls and are included in the Rice Diversity Panel.

Control Value
GSOR 301380: 113; GSOR 301401: 118

Number of Observed Alleles
5