View | Download this marker

Marker details for KG807

Crop Name HAZELNUT
Site National Clonal Germplasm Repository
Repeat Motif Unknown
Primers F: 5'AAGCAAGAAAGGGATGGT3' R: 5'CTTACAGATAAATGGCTCAAA3'
Assay Conditions DNA was extracted from fresh hazelnut leaves according to Lunde et al. (2000). Forward primers for the 21 SSRs were fluorescently labeled with FAM, HEX or NED. Polymerase chain reactions (PCRs) were carried out in a 10 �l volume containing 0.5 �M of primer, 20 ng of template DNA, 0.2 U of Biolase DNA polymerase (Biolase USA, Randolph, MA), 1.5 mM MgCl2 ,120 �M each of dATP, dCTP, dGTP and dTTP and the 1� ammonium-based buffer supplied by the manufacturer. The thermal cycler program of an initial 4 min at 95 oC followed by 40 cycles of 30s at 95 oC, 40 s at the optimum annealing temperature, 40s at 72 oC; 7 min at 72 oC, and ending with an indefinite hold at 4 oC until retrieved from the thermal cycler. Two microliters of labeled PCR product from each primer pair in a multiplex set were combined with autoclaved nanopure water to a final volume of 150 �l. A one �l aliquot of the mixture was separated using an ABI 3730 DNA Analyzer (Applied Biosystems, Life Technologies Corporation, Carlsbad, CA) at the Core Laboratories of the Center for Genome Research and Biocomputing (CGRB) at Oregon State University. Fragment analysis was carried out using Peak ScannerTM Software v 1.0 (Applied Biosystems, Life Technologies Corporation, Carlsbad, CA) and the values were manually entered into a spreadsheet.
Range Products 226-248
Genbank Number EU916939
Map location 11
Polymorphic Type MICROSATELLITE
Comment Derived from internal repeats in ISSR fragments

Citation(s)
  • Study of: CORYLUS.CORVALLIS.GURCAN.MOLBREED.2010. Acta Hort.

Assay details for evaluation CORYLUS.CORVALLIS.GURCAN.MOLBREED.2010
Assay Method
DNA was extracted from young leaves as described by Davis et al. (1998) with the modifications of Lunde et al. (2000). For development of SSR primer pairs from ISSR amplicons, refer to the publication (Gurcan et al., 2010). To characterize the SSRs, forward primers of polymorphic loci were labeled fluorescently with 6-FAM, HEX, or NED and 50 genotypes were amplified under the same PCR conditions as in the initial screening. DNA was amplified by PCR in a 15 ?L mixture containing 12 pM each of forward and reverse primers, 1.6 ?L of 10x Biolase NH4 reaction buffer, 0.036 mM MgCl2, 0.027 M of each of dNTP, 0.25 units of Biolase DNA polymerase, and 3?25 ng of template DNA. The thermal cycler program was 94?C for 5 min; followed by 35 cycles of 94 ?C for 40 s, 30 s at the annealing temperature, 72 ?C for 40 s; and a final 7 min extension step at 72 ?C. The products were separated on 3% agarose gels to verify amplification and polymorphism. A mapping population of 144 seedlings (Mehlenbacher et al. 2006) was amplified at polymorphic SSR loci using fluorescently labeled primers and the same PCR conditions as for characterization. Up to four PCR products were diluted, pooled and the mixture was submitted to the Central Services Laboratory (CSL) of the Center for Genome Research and Biocomputing (CGRB) at OSU where fragments were separated and sized with an ABI 3100 capillary electrophoresis instrument.

Scoring Method
DNA fragment sizes were determined using GeneScan and Genotyper software.

Number of Observed Alleles
4


Assay details for evaluation CORYLUS.CORVALLIS.SATHURALLI.GRCE.2011
Evaluation Method
The objective of this study was to use 21 SSR loci to evaluate genetic diversity in 87 accessions of American hazelnut (Corylus americana) and 68 hybrids between American and European hazelnuts representing a wide geographic range from the USDA-ARS NCGR National collection, OSU hazelnut breeding collection and Arbor Day Foundation. The results of this study were published in Genetic Resources and Crop Evolution DOI 10.1007/s10722-011-9743-0.

Assay Method
DNA was extracted from fresh hazelnut leaves according to Lunde et al. (2000). Forward primers for the 21 SSRs were fluorescently labeled with FAM, HEX or NED. Polymerase chain reactions (PCRs) were carried out in a 10 ?l volume containing 0.5 ?M of primer, 20 ng of template DNA, 0.2 U of Biolase DNA polymerase (Biolase USA, Randolph, MA), 1.5 mM MgCl2 ,120 ?M each of dATP, dCTP, dGTP and dTTP and the 1? ammonium-based buffer supplied by the manufacturer. The thermal cycler program of an initial 4 min at 95 oC followed by 40 cycles of 30s at 95 oC, 40 s at the optimum annealing temperature, 40s at 72 oC; 7 min at 72 oC, and ending with an indefinite hold at 4 oC until retrieved from the thermal cycler. Two microliters of labeled PCR product from each primer pair in a multiplex set were combined with autoclaved nanopure water to a final volume of 150 ?l. A one ?l aliquot of the mixture was separated using an ABI 3730 DNA Analyzer (Applied Biosystems, Life Technologies Corporation, Carlsbad, CA) at the Core Laboratories of the Center for Genome Research and Biocomputing (CGRB) at Oregon State University. Fragment analysis was carried out using Peak ScannerTM Software v 1.0 (Applied Biosystems, Life Technologies Corporation, Carlsbad, CA) and the values were manually entered into a spreadsheet.

Scoring Method
DNA fragment sizes were determined using Peak Scanner TM software.

Number of Observed Alleles
5