View | Download this marker

Marker details for UFFA-03-D11

Crop Name STRAWBERRY
Site National Clonal Germplasm Repository
Repeat Motif (AGA)5
Primers F= 5'GCCTTGATGTCTCGTTGAGTAG3' R= 5'TACCTTCTGCATTCACCATGAC3'
Assay Conditions Seeds and runner plants from F. iinumae and F. nipponica were collected from Hokkaido, Japan during an expedition in 2004 from 22 locations. Seedlings were germinated in pots and grown in greenhouses at the NCGR in Corvallis, Oregon. A total of 137 seedlings successfully germinated and were used for the study. They represented twelve subpopulations (SP) of F. iinumae (SP 1849 � SP 1859 and SP1870) and ten of F. nipponica (SP 1860 � SP 1869). Accessions germinated from each subpopulation were designated by the subpopulation numbers and an additional unique suffix. The subpopulations therefore represent seedlings and/or runner plants (accessions) collected from the same geographical location. Two F. iinumae accessions and one F. nipponica accession previously obtained from Honshu, Japan were included in this study as outgroups. DNA was extracted from actively-growing leaves using a modified protocol based on the PUREGENE� kit (Gentra Systems Inc. Minneapolis, Minn). DNA extraction was carried out in duplicate in 96 well cluster tubes. Twenty SSRs that successfully amplified correctly sized fragments, which were polymorphic between and within both species and that were easy to score were chosen for this study. PCRs were performed in 15 �l total reaction volumes containing: 1 x PCR buffer, 2 mM MgCl2, 0.2 mM each dNTP, 0.3 �M of each primer, 0.05 U of Biolase enzyme (Bioline USA Inc., Randolph, Mass.) and 4.5 ng of DNA template. Allele sizing and visualization was performed using the fragment analysis module of the Beckman CEQ 8000 software. Alleles were scored by fitting the peaks into bins of less than 1 nucleotide. PowerMarker� (ver 3.25) was used to calculate the mean number of alleles per locus.
Range Products 192-203
Genbank Number CO816840
Map location Not mapped
Polymorphic Type MICROSATELLITE

Citation(s)
  • Study of: FRAGARIA.CORVALLIS.NJUGUNA.GRCE.2011. Acta Hort.

Assay details for evaluation FRAGARIA.CORVALLIS.NJUGUNA.GRCE.2011
Evaluation Method
The United States Department of Agriculture (USDA) - Agricultural Research Service (ARS) - National Clonal Germplasm Repository (NCGR) in Corvallis, Oregon, is a genebank that preserves strawberry genetic resources. In 2004, two Asian diploid species, F. iinumae Makino and F. nipponica Makino were collected during an expedition in Hokkaido, Japan. F. iinumae, or its ancestor, may be a progenitor of the `B? genome for the cultivated octoploid strawberry, F. ? ananassa Duschesne. The objective of this study was to evaluate the diversity of these two species? populations using simple sequence repeat (SSR) markers. Twenty of 82 Fragaria derived SSRs, polymorphic among and within the two species were selected for the genetic analysis of 137 Hokkaido accessions. A significant difference in the genetic diversity between the two species was observed; F. nipponica (0.4542) and F. iinumae (0.1808). Three possible interspecific hybrids were identified from their intermediate memberships in the two diploid species groups. Further clustering within the species groups resulted in seven subclusters in F. iinumae and three in F. nipponica that may represent historical lineages useful for long term preservation of the two species. An octoploid accession was identified from SSR analysis and its ploidy confirmed by flow cytometry. The results of this study were published in Genetic Resources and Crop Evolution and is available online at http://www.springerlink.com/content/c404m461448gp6r3/fulltext.html

Assay Method
DNA extraction was carried out in duplicate in 96 well cluster tubes using a modified PUREGENE? kit (Gentra Systems Inc., MN) protocol routinely used at the NCGR. PCRs were performed in 15 ?l total reaction volumes containing: 1 x PCR buffer, 2 mM MgCl2, 0.2 mM each dNTP, 0.3 ?M of each primer (using fluorescently labeled (D2, D3, or D4) forward primers and unlabeled reverse primers), 0.05 U of Biolase enzyme (Bioline USA Inc., Randolph, Mass.) and 4.5 ng of DNA template. DNA was amplified in an Eppendorf Gradient thermocycler (Brinkmann Instruments, Inc., Westbury, NY) or an MJ Research Tetrad thermocycler (MJ Research Inc., Watertown, MA). The success of the PCR reaction was verified by agarose (2%) gel electrophoresis prior to capillary electrophoresis using the CEQ 8000 (Beckman Coulter Inc., Fullerton, CA).

Scoring Method
Allele sizing and visualization was performed using the fragment analysis module of the Beckman CEQ 8000 software. Alleles were scored by fitting the peaks into bins of less than 1 nucleotide.