View | Download this marker

Marker details for B657

Crop Name HAZELNUT
Site National Clonal Germplasm Repository
Repeat Motif (AG)15
Primers F: 5'GAGAGTGCGTCTTCCTCTGG3' R: 5'AGCCTCACCTCCAACGAAC3'
Assay Conditions DNA was extracted from fresh hazelnut leaves according to Lunde et al. (2000). Forward primers for the 21 SSRs were fluorescently labeled with FAM, HEX or NED. Polymerase chain reactions (PCRs) were carried out in a 10 �l volume containing 0.5 �M of primer, 20 ng of template DNA, 0.2 U of Biolase DNA polymerase (Biolase USA, Randolph, MA), 1.5 mM MgCl2 ,120 �M each of dATP, dCTP, dGTP and dTTP and the 1� ammonium-based buffer supplied by the manufacturer. The thermal cycler program of an initial 4 min at 95 oC followed by 40 cycles of 30s at 95 oC, 40 s at the optimum annealing temperature, 40s at 72 oC; 7 min at 72 oC, and ending with an indefinite hold at 4 oC until retrieved from the thermal cycler. Two microliters of labeled PCR product from each primer pair in a multiplex set were combined with autoclaved nanopure water to a final volume of 150 �l. A one �l aliquot of the mixture was separated using an ABI 3730 DNA Analyzer (Applied Biosystems, Life Technologies Corporation, Carlsbad, CA) at the Core Laboratories of the Center for Genome Research and Biocomputing (CGRB) at Oregon State University. Fragment analysis was carried out using Peak ScannerTM Software v 1.0 (Applied Biosystems, Life Technologies Corporation, Carlsbad, CA) and the values were manually entered into a spreadsheet.
Range Products 210-228
Map location 11
Polymorphic Type MICROSATELLITE

Citation(s)
  • Gökirmak, T., S. A. Mehlenbacher, & N. V. Bassil. 2009. Characterization of European hazelnut (Corylus avellana) cultivars using SSR markers. Genet. Resources Crop Evol. 46:147-172. DOI: 10.1007/s10722-008-9352-8. Note: Corvallis
  • Gökirmak, T., S. A. Mehlenbacher, & N. V. Bassil. 2009. Characterization of European hazelnut (Corylus avellana) cultivars using SSR markers. Genet. Resources Crop Evol. 46:147-172. DOI: 10.1007/s10722-008-9352-8. Note: Parlier

Assay details for evaluation CORYLUS.CORVALLIS.BASSIL.ACTA.2009
Evaluation Method
The US Department of Agriculture (USDA), Agricultural Research Service maintains a genebank representing world hazelnut (Corylus L.) diversity. More than 670 clones are preserved as self-rooted trees in a two-hectare field planting in Corvallis, Oregon, with a single tree per accession. In 1996 and 1997, prior to the spread of eastern filbert blight caused by Anisogramma anomala to within 75 kilometers of Corvallis, a backup collection was established in Parlier, California. A core collection of 184 genotypes representing the wide taxonomic, geographic and phenotypic diversity of Corylus was targeted for this second planting. Two trees of each `core? genotype were grafted onto seedling rootstocks over a period of five years and an orchard was established in Parlier. The grafted trees in Parlier are at risk of identity problems due to suckers arising from below the graft union. In May 2007, young leaves were collected from 29 Parlier trees that exhibited uncharacteristic morphological phenotypes. A set of 12 simple sequence repeat (SSR) markers was used to fingerprint trees in the backup collection, and the results were compared to the fingerprints of the same accessions in the Corvallis collection. Based on the results, misidentified accessions were eliminated and the fingerprinting set will be refined further. The results of this study were presented at the VIIth ISHS International Congress on Hazelnut, in Viterbo, Italy and published in Acta Horticulturae 845: 95-102.

Assay Method
DNA was extracted from young, actively growing hazelnut leaves using a Puregene kit (Gentra Systems, Inc., Minneapolis, Minnesota) and a modified protocol developed in our laboratory for which details are available from the senior author. PCR reactions were carried out for each primer pair in an Eppendorf Gradient thermocycler (Eppendorf, Westbury, NY) or an MJ Research (Watertown, Mass.) Tetrad thermocycler. The forward primers were fluorescently labeled with D2, D3 or D4 WellRED dyes obtained from Sigma-Aldrich Inc. (Saint Louis, MO). The 15 ?l reaction volume contained 1X Biolase buffer, 3 mM MgCl2, 300 ?M each of dATP, dCTP, dGTP, and dTTP, 0.45 ?M each of forward and reverse primers, 0.375 units of Biolase Taq DNA polymerase (Bioline Inc., Randolph, MA), and 4 ng of template DNA. The PCR program consisted of 35 cycles of 94?C for 40 s, optimum Ta for 40 s and 72?C for 40 s. A final extension at 72?C for 30 min was used to maximize non-templated adenosine addition to the 5? ends. Once amplification was confirmed by 3% agarose gel electrophoresis, a small amount of PCR product (0.25 ?l for D4-; 0.5 ?l for D3-; and 1 ?l for D2-labeled fragments) was pooled for each multiplex and the mixture was separated by capillary electrophoresis using a Beckman CEQ 8000 genetic analyzer (Beckman Coulter, Inc., Fullerton, CA).

Scoring Method
Allele sizing and visualization was performed using the fragment analysis module of the Beckman CEQ 8000 software. Alleles were scored by fitting the peaks into bins of less than 1 nucleotide.

Number of Observed Alleles
8

Size of Alleles
212-230


Assay details for evaluation CORYLUS.PARLIER.BASSIL.ACTA.2009
Evaluation Method
The US Department of Agriculture (USDA), Agricultural Research Service maintains a genebank representing world hazelnut (Corylus L.) diversity. More than 670 clones are preserved as self-rooted trees in a two-hectare field planting in Corvallis, Oregon, with a single tree per accession. In 1996 and 1997, prior to the spread of eastern filbert blight caused by Anisogramma anomala to within 75 kilometers of Corvallis, a backup collection was established in Parlier, California. A core collection of 184 genotypes representing the wide taxonomic, geographic and phenotypic diversity of Corylus was targeted for this second planting. Two trees of each `core? genotype were grafted onto seedling rootstocks over a period of five years and an orchard was established in Parlier. The grafted trees in Parlier are at risk of identity problems due to suckers arising from below the graft union. In May 2007, young leaves were collected from 29 Parlier trees that exhibited uncharacteristic morphological phenotypes. A set of 12 simple sequence repeat (SSR) markers was used to fingerprint trees in the backup collection, and the results were compared to the fingerprints of the same accessions in the Corvallis collection. Based on the results, misidentified accessions were eliminated and the fingerprinting set will be refined further. The results of this study were presented at the VIIth ISHS International Congress on Hazelnut, in Viterbo, Italy and published in Acta Horticulturae 845: 95-102.

Assay Method
DNA was extracted from young, actively growing hazelnut leaves using a Puregene kit (Gentra Systems, Inc., Minneapolis, Minnesota) and a modified protocol developed in our laboratory for which details are available from the senior author. PCR reactions were carried out for each primer pair in an Eppendorf Gradient thermocycler (Eppendorf, Westbury, NY) or an MJ Research (Watertown, Mass.) Tetrad thermocycler. The forward primers were fluorescently labeled with D2, D3 or D4 WellRED dyes obtained from Sigma-Aldrich Inc. (Saint Louis, MO). The 15 ?l reaction volume contained 1X Biolase buffer, 3 mM MgCl2, 300 ?M each of dATP, dCTP, dGTP, and dTTP, 0.45 ?M each of forward and reverse primers, 0.375 units of Biolase Taq DNA polymerase (Bioline Inc., Randolph, MA), and 4 ng of template DNA. The PCR program consisted of 35 cycles of 94?C for 40 s, optimum Ta for 40 s and 72?C for 40 s. A final extension at 72?C for 30 min was used to maximize non-templated adenosine addition to the 5? ends. Once amplification was confirmed by 3% agarose gel electrophoresis, a small amount of PCR product (0.25 ?l for D4-; 0.5 ?l for D3-; and 1 ?l for D2-labeled fragments) was pooled for each multiplex and the mixture was separated by capillary electrophoresis using a Beckman CEQ 8000 genetic analyzer (Beckman Coulter, Inc., Fullerton, CA).

Scoring Method
Allele sizing and visualization was performed using the fragment analysis module of the Beckman CEQ 8000 software. Alleles were scored by fitting the peaks into bins of less than 1 nucleotide.


Assay details for evaluation CORYLUS.CORVALLIS.SATHURALLI.GRCE.2011
Evaluation Method
The objective of this study was to use 21 SSR loci to evaluate genetic diversity in 87 accessions of American hazelnut (Corylus americana) and 68 hybrids between American and European hazelnuts representing a wide geographic range from the USDA-ARS NCGR National collection, OSU hazelnut breeding collection and Arbor Day Foundation. The results of this study were published in Genetic Resources and Crop Evolution DOI 10.1007/s10722-011-9743-0.

Assay Method
DNA was extracted from fresh hazelnut leaves according to Lunde et al. (2000). Forward primers for the 21 SSRs were fluorescently labeled with FAM, HEX or NED. Polymerase chain reactions (PCRs) were carried out in a 10 ?l volume containing 0.5 ?M of primer, 20 ng of template DNA, 0.2 U of Biolase DNA polymerase (Biolase USA, Randolph, MA), 1.5 mM MgCl2 ,120 ?M each of dATP, dCTP, dGTP and dTTP and the 1? ammonium-based buffer supplied by the manufacturer. The thermal cycler program of an initial 4 min at 95 oC followed by 40 cycles of 30s at 95 oC, 40 s at the optimum annealing temperature, 40s at 72 oC; 7 min at 72 oC, and ending with an indefinite hold at 4 oC until retrieved from the thermal cycler. Two microliters of labeled PCR product from each primer pair in a multiplex set were combined with autoclaved nanopure water to a final volume of 150 ?l. A one ?l aliquot of the mixture was separated using an ABI 3730 DNA Analyzer (Applied Biosystems, Life Technologies Corporation, Carlsbad, CA) at the Core Laboratories of the Center for Genome Research and Biocomputing (CGRB) at Oregon State University. Fragment analysis was carried out using Peak ScannerTM Software v 1.0 (Applied Biosystems, Life Technologies Corporation, Carlsbad, CA) and the values were manually entered into a spreadsheet.

Scoring Method
DNA fragment sizes were determined using Peak Scanner TM software.

Number of Observed Alleles
11