View | Download this marker

Marker details for SSROEUA-DCA3

Crop Name OLIVE
Site Natl. Germplasm Repository - Davis
Repeat Motif (GA)19
Primers Forward: CCCAAGCGGAGGTGTATATTGTTAC Reverse: TGCTTTTGTCGTGTTTGAGATGTTG
Assay Conditions Total DNA was isolated using either the CTAB method (Doyle and Doyle, 1987) or QIAGEN DNeasy Plant Mini-prep Kits (QIAGEN, Valencia, CA) and treated with RNase. Fourteen microsatellite markers were PCR amplified separately in a 10-´L reaction mixture containing 1X Standard Taq Buffer [New England BioLabs, Ipswich, MA (NEB)], 2 mM MgCl2, 0.375 mM each dNTP (ABI), 0.075 units/´l Taq DNA Polymerase (NEB), 0.05 pmol/´l each primer, and approximately 5 ng/´l DNA. PCR reactions were triplexed, i.e. made with three primer pairs combined in one reaction, each pair labeled with a different fluorescent dye. PCR was performed under the following conditions: 1 cycle of 94 C for 5 min, 30 cycles of 94 C for 30 sec, 55 C for 30 sec, and 72 C for 40 sec, and then a final elongation of 72 C for 7 min Amplified products were resolved using capillary electrophoresis on an ABI Prism 3100 Genetic Analyzer. One marker, IAS-pOe12, amplified two loci, and was separated for analysis as IAS-pOe12_A and IAS-pOe12_B, bringing the total number of loci for analysis to fifteen.
Range Products 230-260
Genbank Number AJ279854
Polymorphic Type MICROSATELLITE

Citation(s)
  • Sefc, K. M., M. S. Lopes, D. Mendonca, M. Rodrigues Dos Santos, M. Laimer Da Camara Machado, & A. Da Camara Machado. 2000. Identification of microsatellite loci in olive (Olea europaea) and their characterization in Italian and Iberian olive trees. . Theor. Appl. Genet. 9:1171-1193.

Assay details for evaluation OLIVE.SSR.DAVIS.2009
Evaluation Method
SSR Fingerprint of Olea varieties from Wolfskill Experimental Orchard, Winters, CA.

Assay Method
Total DNA was isolated using either the CTAB method (Doyle and Doyle, 1987) or QIAGEN DNeasy Plant Mini-prep Kits (QIAGEN, Valencia, CA) and treated with RNase. Fourteen microsatellite markers were PCR amplified separately in a 10-�L reaction mixture containing 1X Standard Taq Buffer [New England BioLabs, Ipswich, MA (NEB)], 2 mM MgCl2, 0.375 mM each dNTP (ABI), 0.075 units/�l Taq DNA Polymerase (NEB), 0.05 pmol/�l each primer, and approximately 5 ng/�l DNA. PCR reactions were triplexed, i.e. made with three primer pairs combined in one reaction, each pair labeled with a different fluorescent dye. PCR was performed under the following conditions: 1 cycle of 94 C for 5 min, 30 cycles of 94 C for 30 sec, 55 C for 30 sec, and 72 C for 40 sec, and then a final elongation of 72 C for 7 min Amplified products were resolved using capillary electrophoresis on an ABI Prism 3100 Genetic Analyzer. One marker, IAS-pOe12, amplified two loci, and was separated for analysis as IAS-pOe12_A and IAS-pOe12_B, bringing the total number of loci for analysis to fifteen.

Number of Observed Alleles
2