View | Download this marker

Marker details for IAS-POE12A

Crop Name	OLIVE
Site	Natl. Germplasm Repository - Davis
Repeat Motif	(GA)17
Primers	Forward: ATGAGAGCCCCCATTTTTCT Reverse: CGAATTCCGACTTATGAGCTG
Assay Conditions	Total DNA was isolated using either the CTAB method (Doyle and Doyle, 1987) or QIAGEN DNeasy Plant Mini-prep Kits (QIAGEN, Valencia, CA) and treated with RNase. Fourteen microsatellite markers were PCR amplified separately in a 10-´L reaction mixture containing 1X Standard Taq Buffer [New England BioLabs, Ipswich, MA (NEB)], 2 mM MgCl2, 0.375 mM each dNTP (ABI), 0.075 units/´l Taq DNA Polymerase (NEB), 0.05 pmol/´l each primer, and approximately 5 ng/´l DNA. PCR reactions were triplexed, i.e. made with three primer pairs combined in one reaction, each pair labeled with a different fluorescent dye. PCR was performed under the following conditions: 1 cycle of 94 C for 5 min, 30 cycles of 94 C for 30 sec, 55 C for 30 sec, and 72 C for 40 sec, and then a final elongation of 72 C for 7 min Amplified products were resolved using capillary electrophoresis on an ABI Prism 3100 Genetic Analyzer. One marker, IAS-pOe12, amplified two loci, and was separated for analysis as IAS-pOe12_A and IAS-pOe12_B, bringing the total number of loci for analysis to fifteen.
Range Products	106-123
Genbank Number	AF356039
Polymorphic Type	MICROSATELLITE

Citation(s)

Rallo, P., G. Dorado, & A. Martí n. 2000. Development of simple sequence repeats (SSRs) in olive tree (Olea europaea L.). . Theor. Appl. Genet. 101:984-989. DOI: 10.1007/s001220051571.

Assay details for evaluation OLIVE.SSR.DAVIS.2009

Evaluation Method

SSR Fingerprint of Olea varieties from Wolfskill Experimental Orchard, Winters, CA.

Assay Method

Total DNA was isolated using either the CTAB method (Doyle and Doyle, 1987) or QIAGEN DNeasy Plant Mini-prep Kits (QIAGEN, Valencia, CA) and treated with RNase. Fourteen microsatellite markers were PCR amplified separately in a 10-�L reaction mixture containing 1X Standard Taq Buffer [New England BioLabs, Ipswich, MA (NEB)], 2 mM MgCl2, 0.375 mM each dNTP (ABI), 0.075 units/�l Taq DNA Polymerase (NEB), 0.05 pmol/�l each primer, and approximately 5 ng/�l DNA. PCR reactions were triplexed, i.e. made with three primer pairs combined in one reaction, each pair labeled with a different fluorescent dye. PCR was performed under the following conditions: 1 cycle of 94 C for 5 min, 30 cycles of 94 C for 30 sec, 55 C for 30 sec, and 72 C for 40 sec, and then a final elongation of 72 C for 7 min Amplified products were resolved using capillary electrophoresis on an ABI Prism 3100 Genetic Analyzer. One marker, IAS-pOe12, amplified two loci, and was separated for analysis as IAS-pOe12_A and IAS-pOe12_B, bringing the total number of loci for analysis to fifteen.

Number of Observed Alleles