View | Download this marker

Marker details for CAC-B790

Crop Name HAZELNUT
Site National Clonal Germplasm Repository
Repeat Motif (CT)15(TA)8
Primers Forward: Hex-TGCAGGCTTATGCACATGAT Reverse: AGCCCTCACCTATAACCCTCT
Assay Conditions Optimum Annealing Temperature: 60 C; Seperation: ABI PRISM 377 sequencer (Applied Biosystems); Dye: HEX
Range Products 197-227
Genbank Number FJ98553
Polymorphic Type MICROSATELLITE
Comment Construction of SSR-enriched libraries and primer design: Two dinucleotide (CA and GA) microsatellite-enriched libraries of the European hazelnut were constructed by Genetic Identification Services.

Citation(s)

Assay details for evaluation GURCAN.HAZELNUT.TGG.2010
Evaluation Method
Plant material and DNA extraction Fifty genotypes were used to characterize the SSR loci. Trees of these accessions were present in field collections at the USDA-ARS-NCGR and OSU in Corvallis. We chose 48 from among the 198 unique accessions characterized by Gokirmak et al. (2009) to represent the genetic diversity in our C. avellana collection. The remaining two accessions were the parents of the F1 mapping population of 144 seedlings used for segregation analysis (Mehlenbacher et al. 2006). The maternal parent, OSU 252.146, is susceptible to eastern filbert blight caused by Anisogramma anomala (Peck) E. Muller, while the paternal parent, OSU 414.062, is heterozygous at the resistance locus. Total DNA was extracted from young leaves of field planted trees, as described by Davis et al. (1998), and slightly modified by Lunde et al. (2000). RNA was removed by incubation with RNase. Microsatellite analysis - Construction of SSR-enriched libraries and primer design Two dinucleotide (CA and GA) microsatellite-enriched libraries of the European hazelnut were constructed by Genetic Identification Services. Hazelnut genomic fragments enriched for a microsatellite motif were ligated into the HindIII cut site of pUC19 plasmid, and the recombinant plasmids were electroporated into Escherichia coli strain DH5a. After recovery incubation in SOC broth, glycerol was added to 20% of the final volume. In order to isolate colonies, cells from the glycerol stock were spread on selective X-gal/IPTG/ampicillin plates and incubated overnight at 37 C. White and light blue colonies were transferred onto replicate plates. Plasmid inserts were amplified with universal M13 primers, and the PCR products were separated on 3% agarose gels to determine their size prior to sequencing. Sterile toothpicks were used to add bacteria to the PCR mixture containing 12 pM each of forward and reverse primers, 1x Biolase NH4 reaction buffer, 35 uM MgCl2, 27 ?M each of dNTPs, and 0.25 units of Biolase DNA polymerase (Bioline Inc., Randolph, MA, USA), and water to a total volume of 15 ul. Insert amplification was performed under the following conditions: an initial denaturation at 94 C for 5 min followed by 35 cycles of 94 C for 30 s, 57 C for 30 s, 72 C for 30 s, and a final 2-min extension step at 72 C. For the GA-enriched library, E. coli colonies with inserts of 300?800 bp were amplified in liquid LB medium containing ampicillin, and plasmids were purified using the Perfectprep Plasmid kit (Eppendorf North America) and sequenced by the Core Laboratories of the OSU Center for Genome Research and Biocomputing (CGRB) using an ABI PRISM 377 sequencer (Applied Biosystems). Unique sequences were identified using the Contig Assembly Program 3 (CAP3) program (CGRB Bioinformatics Resources, OSU). Sequences were screened for the presence of SSRs with the program Simple Sequence Repeat Identification Tool (SSRIT) (available online at www. gramene.org/db/markers/ssrtool). Primer pairs flanking the microsatellite loci were designed using the PRIMER3 program (http://frodo.wi.mit.edu/cgi-bin/primer3/ primer3_www.cgi) with the following criteria: 22-24-base pair length, 30-55% GC content, and 60 C annealing temperature. The BigDye Terminator Cycle Sequencing Ready Reaction kit version 2.0 was used to prepare fragments from the CA-enriched library for sequencing with an ABI PRISM 377 sequencer at the University of Torino (Italy). For loci whose flanking sequence was too short to allow design of one of the primers, the sequence of the flanking region was obtained using the GenomeWalker kit (Clontech Laboratories, Mountain View, CA, USA) following the adaptor-ligation nested PCR approach as described in the instructions of the manufacturer.

Assay Method
DNA were amplified by PCR in a 15 ul volume containing water, 12 pM each of forward and reverse primers, 1x Biolase NH4 reaction buffer, 35 uM MgCl2, 27 uM each of dNTPs, 3.5-25 ng of template DNA, and 0.25 units of Biolase DNA polymerase (Bioline Inc., Randolph, MA, USA). The thermal cycler was programmed for denaturation at 94 C for 5 min followed by 35 cycles of 94 C for 40 s, annealing temperature 60 C for 30 s, 72 C for 40 s, and a final 15-min extension step at 72 C. The products were run on 3% agarose gels.

Scoring Method
For loci that appeared polymorphic in the initial screening, forward primers fluorescently labeled with FAM, HEX, or NED were used to amplify 50 genotypes under the same PCR conditions as in the initial screening. For multiplexing, 1 ul of labeled products of each of four primers was combined with distilled water to a final volume of 80 ul. A 1-μl aliquot was submitted to the Core Laboratories of OSU-CGRB where fragment analysis was conducted with an ABI 3100 capillary electrophoresis instrument. For mapping, template DNA of 144 seedlings was amplified with fluorescently labeled SSR primers. Onemicroliter aliquots of four to eight PCR products were multiplexed in 80 ul of distilled water, and a 1-ul aliquot of the mixture was submitted for fragment analysis.

Number of Observed Alleles
13

Size of Alleles
197-227 bp