View | Download this marker

Marker details for MFC3

Crop Name FIG
Site Natl. Germplasm Repository - Davis
Repeat Motif [AC]15TC[AC]8[AT]7
Primers Forward: GATATTTTCATGTTTAGTTTG Reverse: GAGGATAGACCAACAACAAC
Assay Conditions Annealing Temp. 50oC; Separation: ABI3100 capillary electrophoresis
Range Products 98-132
Genbank Number AF333698
Polymorphic Type MICROSATELLITE
Comment M3N1

Citation(s)
  • Khadari, B., I. Hochu, S. Santoni, & F. Kjellberg. 2001. Identification and characterization of microsatellite loci in the common fig (Ficus carica L.) and representative species of the genus Ficus. Molec. Ecol. 1:191-193. DOI: 10.1046/j.1471-8278.2001.00072.x.

Assay details for evaluation FIG.SSR.DAVIS.2009
Evaluation Method
SSR Fingerprint of fig varieties from Wolfskill Experimental Orchard, Winters, CA.

Assay Method
Total DNA was isolated using the CTAB method (Doyle and Doyle, 1987) and further extracted with phenol-chloroform and treated with RNase to remove protein and RNA contaminants, respectively.a Sixteen microsatellite markers were PCR amplified separately in a 10 uL reaction mixture containing 10 mM Tris-HCl, pH 8.3, 50 mM KCl, 2 mM MgCl2 (all included in 10 uL of 10x PCR buffer), 10 pmol of each primer, 200 uM of each dNTP, 2 U of Taq polymerase (Perkin Elmer Biosystems, California, USA), and 50 ng of template DNA.a The PCR condition was as follows: one cycle of 5 min at 94oC, 30 cycles of 94oC for 30s, 50oC for 45s, and 72oC for 1 min followed by one cycle of 7 min at 72oC.a Amplified products were resolved using capillary electrophoresis on an ABI Prism 3100 Genetic Analyzer.

Number of Observed Alleles
2

Size of Alleles
116-132