View | Download this marker

Marker details for GD100

Crop Name APPLE
Site Natl. Germplasm Repository - Geneva
Repeat Motif (GA)12
Primers Forward: 5' ACAGCAAGGTGTTGGGTAAGAAGGT Reverse: 3' TGCGGACAAAGGAAAAAAAAAAGTG
Assay Conditions Extract DNA from leaves, PCR amplify in Perkin Elmer 9600 thermocycler. 2 multiplexed primer sets GD12, 15, and 96 and GD 100 and 103 were PCR amplified in 25 ul reaction mixtures containing 25 nm genomic template DNA, 10-45 pmol of each primer, 0.20 mM of dNTPs, 2.0 mM MgSO4, 1x ThermoPol reaction buffer, and 0.25 units of Deep Vent polymerase (New England Biolabs). The multiplex primer sets GD12, GD15, and GD96 and GD100 and GD103 were amplified following a 4 min denaturation at 94C. Reaction conditions were 25 cycles at 94C for 60 s, 55C primer annealing for 120 s, 72C primer elongation for 120 s, and a 10 min extension at 72C. Amplified products were electrophoresed on an ABI 377 or 272 DNA sequencing system. Golden Delicious was used as the control. Automated sizing of fragements was determined using ABI Genescan 672 sofware ver. 1.2.2-1. relative to an internal lane standard, GEnescan 350 Tamara which was loaded with the amplification products in each lane at the beginning of the run.
Range Products 223-242
Polymorphic Type MICROSATELLITE

Citation(s)
  • Hokanson, S. C., A. K. Szewc-McFadden, W. F. Lamboy, & J. R. McFerson. 1998. Microsatellite (SSR) markers reveal genetic identities, genetic diversity and relationships in a Malus x domestica borkh. core subset collection. Theor. Appl. Genet. 97:671-683.

Assay details for evaluation 2005MALUSSIEVERSIISITES6AND9
Evaluation Method
Phil Forsline and his collaborators brought back Malus sieversii seeds and clones from several collection sites in Kazakhstan in 1995 and 1996. These analyses compare the genetic diversity of 274 M.sieversii individuals from collection site 9 and 174 individuals of M. sieversii from collection site 6. The purpose of the study was to compare allelic diversity with phenotypic diversity and identify core subsets of individuals that capture much of the characterized diversity from these 2 collection sites. This paper has been published (see Evaluation citation).

Assay Method
Leaves of 2 samples of each individual were extracted using DNeasy 96 plant kits (Qiagen). Malus SSRs were amplified with forward primers labeled with either IRD 700 or IRD800 obtained from MWG-Biotech. Unlabeled reverse primers were purchased from IDT (Coralville, Iowa). PCR was carried out in 15 uL total volume. 10-50 ng DNA template and primers (0.3 pM) were combined with 1.5 units Taq polymerase (Promega), 1x Promega Magnesium free buffer (10 mM Tris-HCl, 50 mM KCl, and 0.1% Triton X-100), 0.25 mM MgCl2, adn 0.25 mM dNTP. PCR amplifications were carried out using MJ Research PTC200 or Dyad Thermocyclers. A touch-down program reduced the annealing temperature 2 C every other cycle starting at 63C and ending at 57C, followed by an annealing temperature of 55C for 20 additional cycles, and ended with a 2 min 72C extension. Completed PCR reactins were diluted 1:1 in 95% formamide, 50 mM EDTA, bormophenol blue loading dye, and denatured at 95C for 3 min. Gels (6.5% LI-COR KB Plus acrylamide) were run in 1x TBE (89 mM Tris, 89 mM boric acid, 20 mM EDTA) buffer for 1 h 45 min at 1500 V, 40 W, 40 mA, and 45C on a LI-COR 4200 DNA sequencer.

Scoring Method
Digital images were collected from the sequencer using LI-COR Saga Generation 2 software and were manually analyzed using the Saga software. Alleles from replicate samples were examined at each locus and when alleles for replicates were not identical, data for that locus were entered as missing in subsequent analyses.

Control Value
PI 590184:225,225; PI 588853:226,237; PI 588850:227,235


Assay details for evaluation 2007MALUSORINETALISRUSSIATURKEY
Evaluation Method
Seven microsatellites were used to analyze genetic diversity of 496 Malus orientalis accessions grown from seeds collected in Russia (1998) and Turkey (1999). Results have been published (Volk et al., (2008) J. Am. Soc.Hort. Sci.

Assay Method
Leaves of 2 samples of each individual were extracted using DNeasy 96 plant kits (Qiagen). Malus SSRs were amplified with forward primers labeled with either IRD 700 or IRD800 obtained from MWG-Biotech. Unlabeled reverse primers were purchased from IDT (Coralville, Iowa). PCR was carried out in 15 uL total volume. 10-50 ng DNA template and primers (0.7 pM) were combined with 1.5 units Taq polymerase (Promega), 1x Promega Magnesium free buffer (10 mM Tris-HCl, 50 mM KCl, and 0.1% Triton X-100), 0.25 mM MgCl2, adn 0.25 mM dNTP. PCR amplifications were carried out using MJ Research PTC200 or Dyad Thermocyclers. A touch-down program reduced the annealing temperature 2 C every other cycle starting at 63C and ending at 57C, followed by an annealing temperature of 55C for 20 additional cycles, and ended with a 2 min 72C extension. Completed PCR reactins were diluted 1:1 in 95% formamide, 50 mM EDTA, bormophenol blue loading dye, and denatured at 95C for 3 min. Gels (6.5% LI-COR KB Plus acrylamide) were run in 1x TBE (89 mM Tris, 89 mM boric acid, 20 mM EDTA) buffer for 1 h 45 min at 1500 V, 40 W, 40 mA, and 45C on a LI-COR 4200 DNA sequencer.

Scoring Method
Digital images were collceted from the sequencer using LI-COR Saga Generation 2 software and were manually analyzed using the Saga software. Alleles from replicate samples were examined at each locus and when alleles for replicates were not identical, data for that locus were entered as missing in subsequent analyses.

Control Value
PI 588853 (Coxs Orange Pippin):226,237; PI 590184 (Golden Delicious):225,225; PI 588850 (Rome Beauty Law):227,235

Number of Observed Alleles
2