Details for: PI 684746, Humulus lupulus L. var. lupulus, 'Comet'

Summary Data

Taxonomy:

Humulus lupulus L. var. lupulus

Cultivar:

'Comet'

Origin:

Developed – Oregon, United States

Maintained:

National Clonal Germplasm Repository

Received by NPGS:

02 Apr 2008

Improvement Status:

Cultivar

Reproductive Uniformity:

Hybrid

Form Received:

Rhizome

Life Form:

Perennial

Life Cycle:

Perennial

Availability

This accession is not available. Contact site for status.

National Clonal Germplasm Repository

Due to a recent decrease in resources, we are in the process of restructuring our distribution and are not able to accept requests for this material at this time.

There are no images for this accession.

Core Passport Data

Taxonomy:

Humulus lupulus L. var. lupulus

Cultivar:

'Comet'

Origin:

Developed – Oregon, United States

Maintained:

National Clonal Germplasm Repository

Received by NPGS:

02 Apr 2008

Improvement Status:

Cultivar

Reproductive Uniformity:

Hybrid

Form Received:

Rhizome

Life Form:

Perennial

Life Cycle:

Perennial

Source History

Developed

1975.
Oregon, United States

Developer(s):

Haunold, Alfred, USDA, ARS

Donated

02 April 2008.
Serbia

Donor(s):

Berenji, Janos, Institute of Field and Vegetable Crops

Accession Names and Identifiers

'Comet'

Type: Cultivar name

Group: HOPS

CHUM 1530

Type: Site identifier

Group: LOCAL

Corvallis local number

Narrative

MATURITY: Medium late

LEAF COLOR: Light green early in the season, turning darker green as the season progresses.

SEX: Female

DISEASES: Downy Mildew: susceptible

Verticillium wilt: resistant

Viruses: free of Prunus Necrotic Ringspot Virus and Hop Mosaic Virus.

VIGOR: Excellent

POLLEN SHEDDING: Very good, 1700 to 2000 lbs per acre

SIDE ARM LENGTH: 24 40 inches

ALPHA ACIDS: 11.3% (8 year range: 9.4 to 12.4%)

BETA ACIDS: 4.6% (8 year range: 3.0 to 6.1%)

COHUMULONE: 41%

STORAGE STABILITY: Good to very good

OIL: 1.98 ml/100 g (8 year range: 1.40 to 3.31%)

MAJOR TRAITS: Relatively high alpha acids content; Wild American aroma that is objectionable to some brewers, highly resistant (perhaps immune) to Prunus Necrotic Ringspot virus infection, yellowish green leaf color early in the season.

OTHER INFORMATION: Released as high alpha hop primarily for production in Washington and Idaho. Acreage expanded to 635 acres in 1980 (1% of US production), but declined after 1981 following the release of super alpha hops. Comet is no longer grown commercially.

Humulus lupulus L. var. lupulus

Genus:

Humulus

Family:

Cannabaceae

Nomen number:

415440

Verified:

11/10/1999 by ARS Systematic Botanists.

Other conspecific taxa

Humulus lupulus L. (10 active accession[s])
Humulus lupulus L. var. cordifolius (Miq.) Maxim. (1 active accession[s])
Humulus lupulus L. var. lupuloides E. Small (143 active accession[s])
Humulus lupulus L. var. neomexicanus A. Nelson & Cockerell (96 active accession[s])
Humulus lupulus L. var. pubescens E. Small (10 active accession[s])

Autonyms (not in current use), synonyms and invalid designations

Common names

Language	Name	seq	Citation
English	common hop	1	Erhardt, W. et al. 2008. Der große Zander: Enzyklopädie der Pflanzennamen 1470.
English	European hop	1	Huxley, A., ed. 1992. The new Royal Horticultural Society dictionary of gardening
English	hop	1	Wiersema, J. H. & B. León. 1999. World economic plants: a standard reference CRC Press, Boca Raton, FL.
French	houblon	2	Rehm, S. 1994. Multilingual dictionary of agronomic plants
German	gewöhnlicher Hopfen	2	Erhardt, W. et al. 2008. Der große Zander: Enzyklopädie der Pflanzennamen 1470.
German	Hopfen	2	Rehm, S. 1994. Multilingual dictionary of agronomic plants
Portuguese	lúpulo	2	Rehm, S. 1994. Multilingual dictionary of agronomic plants
Portuguese (Brazil)	lúparo	2	Groth, D. 2005. pers. comm. Note: re. Brazilian common names
Portuguese (Brazil)	vinho-do-norte	2	Groth, D. 2005. pers. comm. Note: re. Brazilian common names
Spanish	lúpulo	2	Rehm, S. 1994. Multilingual dictionary of agronomic plants
Transcribed Chinese	pi jiu hua	2	Wu Zheng-yi & P. H. Raven et al., eds. 1994-. Flora of China (English edition).
Transcribed Korean	hop	2	Mun-Chan, B. et al. 1986. A checklist of the Korean cultivated plants. Kulturpflanze 34:103.

Annotations

Observations

Phenotype Data

Category	Descriptor	Description	Value	Study	Inventory	Availability
MOLECULAR	HI_AGA7	Motif: (CAT)3N3(CTT)9N3(CTT)3 F: ACAAGCAGTAATGATGAGGA R: TCCAAGTCTCTCAATTAGGAA	178:197	Driskill et al. 2021 unpublished-SSR data	CHUM 1530 .001 PL	Not Available
MOLECULAR	K10315842	Motif: (TGG)8 F: CTCAACTACCCTCTCGTCTG R: TAGCTGGAATGAGCGAAGTA	267:279	Driskill et al. 2021 unpublished-SSR data	CHUM 1530 .001 PL	Not Available
MOLECULAR	K10315910	Motif: (CTT)7 F: GATAGCCAATCTGGTATGGA R: GGGTAACGAAATCCCTAACT	362:369	Driskill et al. 2021 unpublished-SSR data	CHUM 1530 .001 PL	Not Available
MOLECULAR	K10316221 pig	Motif: (TCT)7 F: GTTGTTCTCTTCCAACCAAG Rp: GTTTCCAAAGAAGACCCATTACAG	119:156	Driskill et al. 2021 unpublished-SSR data	CHUM 1530 .001 PL	Not Available
MOLECULAR	Hop Primer 1	Motif: (CTT)n F: AACAAGCTCTGGTAATAACAACAT R: AAAACAAGAACCAGAGATAAGGAC	241:250	Driskill et al. 2021 unpublished-SSR data	CHUM 1530 .001 PL	Not Available
MOLECULAR	Hop Primer 6	Motif: T/A, GAA/TTC F: AAAGCGAAAACTCATGAAAAGGTT R: GACACATGTAAGGTGACCTTTACA	228:240	Driskill et al. 2021 unpublished-SSR data	CHUM 1530 .001 PL	Not Available
MOLECULAR	K10315931 pig	Motif: (CTT)7 F: TCTCCCTAAATGCTATTGTCA Rp: GTTTCGATCATTAGGGTTGAATC	309:312	Driskill et al. 2021 unpublished-SSR data	CHUM 1530 .001 PL	Not Available
MOLECULAR	K10316016	Motif: (AAT)5 F: TACAGGTGCAGTAGCTCAAA R: ATCAAGCTCCTCTAAACCCT	391:397	Driskill et al. 2021 unpublished-SSR data	CHUM 1530 .001 PL	Not Available
MOLECULAR	ACA1-K9-3	Motif: (TTC)17 F: ATCCTTCTCTCATTACATACTCAGC R: CCTATGACGGTTCTTATGAGTGC	189:211	Driskill et al. 2021 unpublished-SSR data	CHUM 1530 .001 PL	Not Available