Details for: PI 617281, Humulus lupulus L. var. lupulus, Osvald Saazer Clone 72Y

Summary Data

Taxonomy:

Humulus lupulus L. var. lupulus

Top Name:

Osvald Saazer Clone 72Y

Origin:

Developed – Czech Republic

Maintained:

National Clonal Germplasm Repository

Received by NPGS:

12 Mar 1992

Improvement Status:

Breeding material

Reproductive Uniformity:

Hybrid

Form Received:

Plant

Life Form:

Perennial

Life Cycle:

Perennial

Availability

This accession is not available. Contact site for status.

National Clonal Germplasm Repository

Due to a recent decrease in resources, we are in the process of restructuring our distribution and are not able to accept requests for this material at this time.

Images (1 total. Click on image for more.)

Core Passport Data

Taxonomy:

Humulus lupulus L. var. lupulus

Top Name:

Osvald Saazer Clone 72Y

Origin:

Developed – Czech Republic

Maintained:

National Clonal Germplasm Repository

Received by NPGS:

12 Mar 1992

Improvement Status:

Breeding material

Reproductive Uniformity:

Hybrid

Form Received:

Plant

Life Form:

Perennial

Life Cycle:

Perennial

Source History

Developed

Czech Republic

Developer(s):

Osvald, F.

Donated

12 March 1992.
Oregon, United States
Comment: Selected from meristem tip culture/heat treated USDA 21525 at Prosser, WA in 1989
Donor(s):

Haunold, Alfred, USDA, ARS

Accession Names and Identifiers

Osvald Saazer Clone 72Y

Type: Site identifier

Group: HOPS

USDA 21535

Type: Donor identifier

Group: OTHERNUM

Dr. A. Haunold, USDA/ARS/Hops Research Project, Corvallis

CHUM 800

Type: Site identifier

Group: LOCAL

Corvallis local number

Narrative

Pleasant (noble) aroma suitable for production of super premium beers, mild bitterness, esp. suited for Pilsner

Cultivar Synonym= USDA 21535

NAMED FOR= Osvald, breeder

Humulus lupulus L. var. lupulus

Genus:

Humulus

Family:

Cannabaceae

Nomen number:

415440

Verified:

11/10/1999 by ARS Systematic Botanists.

Other conspecific taxa

Humulus lupulus L. (10 active accession[s])
Humulus lupulus L. var. cordifolius (Miq.) Maxim. (1 active accession[s])
Humulus lupulus L. var. lupuloides E. Small (143 active accession[s])
Humulus lupulus L. var. neomexicanus A. Nelson & Cockerell (96 active accession[s])
Humulus lupulus L. var. pubescens E. Small (10 active accession[s])

Autonyms (not in current use), synonyms and invalid designations

Common names

Language	Name	seq	Citation
English	common hop	1	Erhardt, W. et al. 2008. Der große Zander: Enzyklopädie der Pflanzennamen 1470.
English	European hop	1	Huxley, A., ed. 1992. The new Royal Horticultural Society dictionary of gardening
English	hop	1	Wiersema, J. H. & B. León. 1999. World economic plants: a standard reference CRC Press, Boca Raton, FL.
French	houblon	2	Rehm, S. 1994. Multilingual dictionary of agronomic plants
German	gewöhnlicher Hopfen	2	Erhardt, W. et al. 2008. Der große Zander: Enzyklopädie der Pflanzennamen 1470.
German	Hopfen	2	Rehm, S. 1994. Multilingual dictionary of agronomic plants
Portuguese	lúpulo	2	Rehm, S. 1994. Multilingual dictionary of agronomic plants
Portuguese (Brazil)	lúparo	2	Groth, D. 2005. pers. comm. Note: re. Brazilian common names
Portuguese (Brazil)	vinho-do-norte	2	Groth, D. 2005. pers. comm. Note: re. Brazilian common names
Spanish	lúpulo	2	Rehm, S. 1994. Multilingual dictionary of agronomic plants
Transcribed Chinese	pi jiu hua	2	Wu Zheng-yi & P. H. Raven et al., eds. 1994-. Flora of China (English edition).
Transcribed Korean	hop	2	Mun-Chan, B. et al. 1986. A checklist of the Korean cultivated plants. Kulturpflanze 34:103.

Annotations

Taxonomic Re-Identification: 31 Oct 2010, from Humulus lupulus L. to Humulus lupulus L. var. lupulus

Observations

Phenotype Data

Category	Descriptor	Description	Value	Study	Inventory	Availability
MOLECULAR	HI_AGA7	Motif: (CAT)3N3(CTT)9N3(CTT)3 F: ACAAGCAGTAATGATGAGGA R: TCCAAGTCTCTCAATTAGGAA	178:206	Driskill et al. 2021 unpublished-SSR data	CHUM 800 .002 PL	Not Available
MOLECULAR	K10315842	Motif: (TGG)8 F: CTCAACTACCCTCTCGTCTG R: TAGCTGGAATGAGCGAAGTA	267:285	Driskill et al. 2021 unpublished-SSR data	CHUM 800 .002 PL	Not Available
MOLECULAR	K10315910	Motif: (CTT)7 F: GATAGCCAATCTGGTATGGA R: GGGTAACGAAATCCCTAACT	369	Driskill et al. 2021 unpublished-SSR data	CHUM 800 .002 PL	Not Available
MOLECULAR	K10316221 pig	Motif: (TCT)7 F: GTTGTTCTCTTCCAACCAAG Rp: GTTTCCAAAGAAGACCCATTACAG	140:156	Driskill et al. 2021 unpublished-SSR data	CHUM 800 .002 PL	Not Available
MOLECULAR	Hop Primer 1	Motif: (CTT)n F: AACAAGCTCTGGTAATAACAACAT R: AAAACAAGAACCAGAGATAAGGAC	250:253	Driskill et al. 2021 unpublished-SSR data	CHUM 800 .002 PL	Not Available
MOLECULAR	Hop Primer 6	Motif: T/A, GAA/TTC F: AAAGCGAAAACTCATGAAAAGGTT R: GACACATGTAAGGTGACCTTTACA	249	Driskill et al. 2021 unpublished-SSR data	CHUM 800 .002 PL	Not Available
MOLECULAR	K10315931 pig	Motif: (CTT)7 F: TCTCCCTAAATGCTATTGTCA Rp: GTTTCGATCATTAGGGTTGAATC	309:312	Driskill et al. 2021 unpublished-SSR data	CHUM 800 .002 PL	Not Available
MOLECULAR	K10316016	Motif: (AAT)5 F: TACAGGTGCAGTAGCTCAAA R: ATCAAGCTCCTCTAAACCCT	391:397	Driskill et al. 2021 unpublished-SSR data	CHUM 800 .002 PL	Not Available
MOLECULAR	ACA1-K9-3	Motif: (TTC)17 F: ATCCTTCTCTCATTACATACTCAGC R: CCTATGACGGTTCTTATGAGTGC	174:211	Driskill et al. 2021 unpublished-SSR data	CHUM 800 .002 PL	Not Available