Details for: PI 688668, Humulus lupulus L. var. lupulus, Scarlet

Summary Data

Taxonomy:

Humulus lupulus L. var. lupulus

Top Name:

Scarlet

Origin:

Developed – Oregon, United States

Maintained:

National Clonal Germplasm Repository

Received by NPGS:

21 Sep 2018

Improvement Status:

Cultivar

Reproductive Uniformity:

Hybrid

Form Received:

Plant

Life Form:

Perennial

Life Cycle:

Perennial

Availability

This accession is not available. Contact site for status.

National Clonal Germplasm Repository

Due to a recent decrease in resources, we are in the process of restructuring our distribution and are not able to accept requests for this material at this time.

There are no images for this accession.

Core Passport Data

Taxonomy:

Humulus lupulus L. var. lupulus

Top Name:

Scarlet

Origin:

Developed – Oregon, United States

Maintained:

National Clonal Germplasm Repository

Received by NPGS:

21 Sep 2018

Improvement Status:

Cultivar

Reproductive Uniformity:

Hybrid

Form Received:

Plant

Life Form:

Perennial

Life Cycle:

Perennial

Source History

Developed

21 September 2018.
Oregon, United States

Developer(s):

Accession Names and Identifiers

Scarlet

Type: Site identifier

Group: HOPS

Townsend, Shaun Oregon State University

USDA 21741

Type: Developer identifier

Group: OTHERNUM

other identifier

USDA Scarlet

Type: Donor identifier

Group: SYNONYM

CHUM 1611

Type: Site identifier

Group: LOCAL

Corvallis local number

CHUM 1597

Type: Site identifier

Group: LOCAL

duplicate inventory

Narrative

In response to requests from the ornamental nursery industry, the Agricultural Research Service (ARS) have released a new ornamental hop, 'USDA SCARLET' (herein called SCARLET; USDA accession number 21741). SCARLET is more vigorous than its' female parent 'Blue Northern Brewer', is moderately resistant to downy mildew (Pseudoperonospora humuli (Miy. et. Tak., G.W. Wilson), and has increased resistance to the two-spotted spider mite (Tetranichus urticae (Koch).

SCARLET, a female plant, originated from a cross made by USDA-ARS personnel between 'Blue Northern Brewer' (USDA 21079) and the USDA male 21329M. Blue Northern Brewer is thought to have originated from 'Northern Brewer' (USDA 64107) but no specific information was provided when it was introduced through germplasm exchange from Belgium in 1974. The male parent, USDA 21329, was developed from a cross between 'Comet' (USDA 62013) and the male USDA 21111M. Assuming Blue Northern Brewer is a mutation of Northern Brewer, the genetic composition of SCARLET is 1/2 ‘Northern Brewer’, 1/4 Comet, 1/8 'Bullion', 1/32 Hallertauer ‘Mittlefrueh’, and 3/32 unknown.

The original cross from which SCARLET originated was made in 1994, and the initial selection number was 9418-44. A single hill was established in the USDA-ARS hop nursery near Corvallis, Oregon in 1995. Evaluation of quality and agronomic characteristics was initiated in 1996, but due to personnel turnover in the hop program beginning in 1996, evaluations were not completed until 2005. Three years of chemical content and five years of agronomic data have been collected.

SCARLET grows quickly and routinely reaches the top trellis wire (18 feet, 5.5 m) in western Oregon whereas Blue Northern Brewer does not. SCARLET is very similar to Blue Northern Brewer in appearance and is characterized by leaves that are often 3-lobed and exhibit a dark blue-green color, dark purple stems, and a reddish tinge to the cones. Side-arms are very short and foliage is relatively sparse compared to typical hop cultivars used for commercial production. Flowering occurs in early July and ploidy is diploid (2n=2x=20).

Although SCARLET is intended as an ornamental, chemical data were collected to help characterize the genotype. SCARLET contains almost twice the amount of alpha acid (3-year average = 10.63% v/v) and beta acid (3-year average = 3.79% v/v) than Blue Northern Brewer (alpha = 6.1% v/v, beta = 2.5% v/v). As a result, the alpha-ratio of SCARLET [Alpha% v/v / (Alpha % v/v + Beta% v/v) = 74] is slightly higher than the alpha-ratio of Blue Northern Brewer (alpha ratio = 71). Hop storage index over 3 years was 0.25 while cohumulone content was measured at 25.3% (v/v). Finally, colupulone amounts averaged 48.56% v/v.

This cultivar produced on average 1.90 mL/100 mg oil content with relatively low levels of myrcene (29.53% v/v) and beta-caryophyllene (13.12% v/v). On the other hand, SCARLET produced high levels of humulene (34.4% v/v) with moderate levels of linalool (0.32% v/v) and limonene (0.80% v/v). While no brewing trials have been conducted with SCARLET, a pleasant “hoppy” aroma coupled with the above chemistry suggest that home brewing with hops from this ornamental line would prove a viable use.

SCARLET exhibits some symptoms of downy mildew infection in the spring but quickly recovers to produce healthy foliage. Based on five years of field observations, SCARLET is considered tolerant to downy mildew. Very little powdery mildew [Podospheara macularis Braun & Takamatus] has been observed in the field, however, numerous lesions formed on SCARLET in a greenhouse. This cultivar has not been tested for resistance to R6-tolerant races of powdery mildew and appropriate protections should be utilized accordingly until better information of resistance is available. Plants continued to grow vigorously in spite of the powdery mildew infection thus SCARLET is considered tolerant to this pathogen. Powdery mildew can be controlled via readily available fungicides. SCARLET's susceptibility to virus infections is unknown. Severe infestations of two-spotted spider mites (Tetranychus urticae Koch) have been observed in plants growing next to SCARLET in the field, however, very few mites were observed on SCARLET. Thus, SCARLET may possess resistance to the two-spotted spider mite. Damson hop aphid (Phorodon humuli Schrank) infestations have not been observed on SCARLET or neighboring plants so resistance to this pest is currently unknown.

SCARLET should provide the U.S. ornamentals nursery industry with a more vigorous alternative to Blue Northern Brewer for commercial use. Genetic material of this release has been deposited in the National Germplasm System at the USDA-Pacific Northwest Clonal Repository near Corvallis, OR. This material will be available for research purposes including the development and commercialization of new cultivars. It is requested that appropriate recognition be given if this cultivar contributes to the development of a new breeding line or cultivar.

Humulus lupulus L. var. lupulus

Genus:

Humulus

Family:

Cannabaceae

Nomen number:

415440

Verified:

11/10/1999 by ARS Systematic Botanists.

Other conspecific taxa

Humulus lupulus L. (10 active accession[s])
Humulus lupulus L. var. cordifolius (Miq.) Maxim. (1 active accession[s])
Humulus lupulus L. var. lupuloides E. Small (143 active accession[s])
Humulus lupulus L. var. neomexicanus A. Nelson & Cockerell (96 active accession[s])
Humulus lupulus L. var. pubescens E. Small (10 active accession[s])

Autonyms (not in current use), synonyms and invalid designations

Common names

Language	Name	seq	Citation
English	common hop	1	Erhardt, W. et al. 2008. Der große Zander: Enzyklopädie der Pflanzennamen 1470.
English	European hop	1	Huxley, A., ed. 1992. The new Royal Horticultural Society dictionary of gardening
English	hop	1	Wiersema, J. H. & B. León. 1999. World economic plants: a standard reference CRC Press, Boca Raton, FL.
French	houblon	2	Rehm, S. 1994. Multilingual dictionary of agronomic plants
German	gewöhnlicher Hopfen	2	Erhardt, W. et al. 2008. Der große Zander: Enzyklopädie der Pflanzennamen 1470.
German	Hopfen	2	Rehm, S. 1994. Multilingual dictionary of agronomic plants
Portuguese	lúpulo	2	Rehm, S. 1994. Multilingual dictionary of agronomic plants
Portuguese (Brazil)	lúparo	2	Groth, D. 2005. pers. comm. Note: re. Brazilian common names
Portuguese (Brazil)	vinho-do-norte	2	Groth, D. 2005. pers. comm. Note: re. Brazilian common names
Spanish	lúpulo	2	Rehm, S. 1994. Multilingual dictionary of agronomic plants
Transcribed Chinese	pi jiu hua	2	Wu Zheng-yi & P. H. Raven et al., eds. 1994-. Flora of China (English edition).
Transcribed Korean	hop	2	Mun-Chan, B. et al. 1986. A checklist of the Korean cultivated plants. Kulturpflanze 34:103.

Annotations

Observations

Phenotype Data

Category	Descriptor	Description	Value	Study	Inventory	Availability
MOLECULAR	HI_AGA7	Motif: (CAT)3N3(CTT)9N3(CTT)3 F: ACAAGCAGTAATGATGAGGA R: TCCAAGTCTCTCAATTAGGAA	178:181:209	Driskill et al. 2021 unpublished-SSR data	CHUM 1597 .001 PL	Not Available
MOLECULAR	K10315842	Motif: (TGG)8 F: CTCAACTACCCTCTCGTCTG R: TAGCTGGAATGAGCGAAGTA	267:285	Driskill et al. 2021 unpublished-SSR data	CHUM 1597 .001 PL	Not Available
MOLECULAR	K10315910	Motif: (CTT)7 F: GATAGCCAATCTGGTATGGA R: GGGTAACGAAATCCCTAACT	369	Driskill et al. 2021 unpublished-SSR data	CHUM 1597 .001 PL	Not Available
MOLECULAR	K10316221 pig	Motif: (TCT)7 F: GTTGTTCTCTTCCAACCAAG Rp: GTTTCCAAAGAAGACCCATTACAG	137:143:156	Driskill et al. 2021 unpublished-SSR data	CHUM 1597 .001 PL	Not Available
MOLECULAR	Hop Primer 1	Motif: (CTT)n F: AACAAGCTCTGGTAATAACAACAT R: AAAACAAGAACCAGAGATAAGGAC	235:250:253	Driskill et al. 2021 unpublished-SSR data	CHUM 1597 .001 PL	Not Available
MOLECULAR	Hop Primer 6	Motif: T/A, GAA/TTC F: AAAGCGAAAACTCATGAAAAGGTT R: GACACATGTAAGGTGACCTTTACA	240	Driskill et al. 2021 unpublished-SSR data	CHUM 1597 .001 PL	Not Available
MOLECULAR	K10315931 pig	Motif: (CTT)7 F: TCTCCCTAAATGCTATTGTCA Rp: GTTTCGATCATTAGGGTTGAATC	312	Driskill et al. 2021 unpublished-SSR data	CHUM 1597 .001 PL	Not Available
MOLECULAR	K10316016	Motif: (AAT)5 F: TACAGGTGCAGTAGCTCAAA R: ATCAAGCTCCTCTAAACCCT	391:397	Driskill et al. 2021 unpublished-SSR data	CHUM 1597 .001 PL	Not Available
MOLECULAR	ACA1-K9-3	Motif: (TTC)17 F: ATCCTTCTCTCATTACATACTCAGC R: CCTATGACGGTTCTTATGAGTGC	189:199:211	Driskill et al. 2021 unpublished-SSR data	CHUM 1597 .001 PL	Not Available
MOLECULAR	HK 000089F_317093	KASP Assay Primer Allele X: GAGCTCCAGGCTGCCAG KASP Assay Primer Allele Y: GCTGAGCTCCAGGCTGCCAA KASP Assay Primer Common: TTTTGGCAGTTCGCTCAGCGGTTA	T/C	Driskill et al. 2021 unpublished-SNP data	CHUM 1597 .001 PL	Not Available
MOLECULAR	HK 000265F_1374141	KASP Assay Primer Allele X: AAATTATGTGACTCGGGATAGTAAGGT KASP Assay Primer Allele Y: ATGTGACTCGGGATAGTAAGGC KASP Assay Primer Common: GAGCTATCAAGCAGGCCGTGCA	G/G	Driskill et al. 2021 unpublished-SNP data	CHUM 1597 .001 PL	Not Available
MOLECULAR	HK 000571F_797591	KASP Assay Primer Allele X: GAGACCGCATGAAGCGACGTA KASP Assay Primer Allele Y: GAGACCGCATGAAGCGACGTC KASP Assay Primer Common: CCGCCGTGGCCACGCTCAA	C/A	Driskill et al. 2021 unpublished-SNP data	CHUM 1597 .001 PL	Not Available
MOLECULAR	HK 001644F_470045	KASP Assay Primer Allele X: CCGATCCCGGCTCCCAGA KASP Assay Primer Allele Y: CCGATCCCGGCTCCCAGC KASP Assay Primer Common: GGGACGGCAGCTGCGGCTT	C/A	Driskill et al. 2021 unpublished-SNP data	CHUM 1597 .001 PL	Not Available
MOLECULAR	HK 002381F_371663	KASP Assay Primer Allele X: ACCGCAGCCTGAGACCGGT KASP Assay Primer Allele Y: CCGCAGCCTGAGACCGGC KASP Assay Primer Common: CAATTCACGACGAGTAGTAGTACTACTAT	G/G	Driskill et al. 2021 unpublished-SNP data	CHUM 1597 .001 PL	Not Available
MOLECULAR	HK 003591F_48935	KASP Assay Primer Allele X: GAGCAGAACGGCGACTTTGAGA KASP Assay Primer Allele Y: GAGCAGAACGGCGACTTTGAGT KASP Assay Primer Common: CTTGCGCTGCACCATGCCTCAT	T/A	Driskill et al. 2021 unpublished-SNP data	CHUM 1597 .001 PL	Not Available
MOLECULAR	HK 008739F_51678	KASP Assay Primer Allele X: CAGCGATCCAATTACAGCAACATG KASP Assay Primer Allele Y: GCAGCGATCCAATTACAGCAACATA KASP Assay Primer Common: CGGTTGAAAACATCTCATTTCGTCACTAA	T/C	Driskill et al. 2021 unpublished-SNP data	CHUM 1597 .001 PL	Not Available
MOLECULAR	HK 000115F_1068460	KASP Assay Primer Allele X: CGATAGCAGAACATTATAACCTCTATTC KASP Assay Primer Allele Y: CGATAGCAGAACATTATAACCTCTATTT KASP Assay Primer Common: GAACTTGCCGCAAAGCAGCTCCTT	T/C	Driskill et al. 2021 unpublished-SNP data	CHUM 1597 .001 PL	Not Available
MOLECULAR	HK 001589F_351349	KASP Assay Primer Allele X: CACCAGAAAGTGTCGATTCCCAT KASP Assay Primer Allele Y: CACCAGAAAGTGTCGATTCCCAC KASP Assay Primer Common: CGGTGTCATAGCAGCTGGGTGTT	G/A	Driskill et al. 2021 unpublished-SNP data	CHUM 1597 .001 PL	Not Available
MOLECULAR	HK 002878F_402249	KASP Assay Primer Allele X: GGAGGCAGGGTCTACTGTTGTA KASP Assay Primer Allele Y: GGAGGCAGGGTCTACTGTTGTT KASP Assay Primer Common: AGCTAAACCAATTGAGCCCAATCCAAAA	T/A	Driskill et al. 2021 unpublished-SNP data	CHUM 1597 .001 PL	Not Available
MOLECULAR	HK 003765F_59789	KASP Assay Primer Allele X: GCCGTTGGTTGGTTTAGTCGGAA KASP Assay Primer Allele Y: CCGTTGGTTGGTTTAGTCGGAC KASP Assay Primer Common: CCACCCCATCATCCCCCACTTA	A/A	Driskill et al. 2021 unpublished-SNP data	CHUM 1597 .001 PL	Not Available
MOLECULAR	HK 23F_2218589	KASP Assay Primer Allele X: AACAAGATCAGCATCAGCACAGACA KASP Assay Primer Allele Y: CAAGATCAGCATCAGCACAGACC KASP Assay Primer Common: CTGCTGACCATTACTACTCAGATCATTA	C/A	Driskill et al. 2021 unpublished-SNP data	CHUM 1597 .001 PL	Not Available
MOLECULAR	HK 63_359415F	KASP Assay Primer Allele X: GCTTTGTGGTTGGCTAGAC KASP Assay Primer Allele Y: GGCTGCTTTGTGGTTGGCTAGAT KASP Assay Primer Common: CAGGCAGCCCTTCCAAGCAGAA	T/C	Driskill et al. 2021 unpublished-SNP data	CHUM 1597 .001 PL	Not Available
MOLECULAR	HK 122F_1097361	KASP Assay Primer Allele X: CAGCTACGCCTCGGCGTCAA KASP Assay Primer Allele Y: CAGCTACGCCTCGGCGTCAT KASP Assay Primer Common: GAGAGCTGCAGCGTGGAGTCAA	T/A	Driskill et al. 2021 unpublished-SNP data	CHUM 1597 .001 PL	Not Available
MOLECULAR	HK 198F_1478737	KASP Assay Primer Allele X: GTGGCTGCAACAAGGCACTAC KASP Assay Primer Allele Y: GGTGGCTGCAACAAGGCACTAT KASP Assay Primer Common: GAGTCTCGAATCTCAGCAGCATACTT	C/C	Driskill et al. 2021 unpublished-SNP data	CHUM 1597 .001 PL	Not Available
MOLECULAR	HK 559F_410159	KASP Assay Primer Allele X: ACTTTCCAAAGCTAAATCCGAGAC KASP Assay Primer Allele Y: CTACTTTCCAAAGCTAAATCCGAGAA KASP Assay Primer Common: CATCCAGTTGGCTGCCAGTTATCTT	G/G	Driskill et al. 2021 unpublished-SNP data	CHUM 1597 .001 PL	Not Available
MOLECULAR	HK 1037F_456722	KASP Assay Primer Allele X: AGAGGCAAGGTGCAACATAATA KASP Assay Primer Allele Y: CTAGAGGCAAGGTGCAACATAATG KASP Assay Primer Common: GCAGCGTAGTATCTGAGCTAGGATT	A/A	Driskill et al. 2021 unpublished-SNP data	CHUM 1597 .001 PL	Not Available
MOLECULAR	HK 1345_507801	KASP Assay Primer Allele X: CACCAGCAGCAAGCTTGGAAC KASP Assay Primer Allele Y: GCACCAGCAGCAAGCTTGGAAT KASP Assay Primer Common: CGCCCAAAACATGGCCCTGGTA	T/T	Driskill et al. 2021 unpublished-SNP data	CHUM 1597 .001 PL	Not Available
MOLECULAR	HK 1371F_177062	KASP Assay Primer Allele X: GGTAGCAGCAACAGCCCTCTT KASP Assay Primer Allele Y: GGTAGCAGCAACAGCCCTCTG KASP Assay Primer Common: GTTGGATGCACTGGAAATGGTTCCAT	C/A	Driskill et al. 2021 unpublished-SNP data	CHUM 1597 .001 PL	Not Available
MOLECULAR	HK 1808F_307171	KASP Assay Primer Allele X: AACAGCTATTAAATATGTTGAGATCAGCT KASP Assay Primer Allele Y: AACAGCTATTAAATATGTTGAGATCAGCA KASP Assay Primer Common: CTGACCCACATAAGCAATTGGGCTA	T/A	Driskill et al. 2021 unpublished-SNP data	CHUM 1597 .001 PL	Not Available
MOLECULAR	HK 2181F_220335	KASP Assay Primer Allele X: AAACAATTTCTCGTACTGAGCCCCA KASP Assay Primer Allele Y: CAATTTCTCGTACTGAGCCCCG KASP Assay Primer Common: CAGCCATATTTGTGAGGACGGCAAA	A/A	Driskill et al. 2021 unpublished-SNP data	CHUM 1597 .001 PL	Not Available
MOLECULAR	HK 2814F_80926	KASP Assay Primer Allele X: GGTGCTGGATATGGAGGTGC KASP Assay Primer Allele Y: GTGGTGCTGGATATGGAGGTGA KASP Assay Primer Common: TCCACCAGCTCCATGACCACCT	T/G	Driskill et al. 2021 unpublished-SNP data	CHUM 1597 .001 PL	Not Available
MOLECULAR	HK 2925F_116637	KASP Assay Primer Allele X: TAGCAGCGCCTACTCTGTG KASP Assay Primer Allele Y: GCTTAGCAGCGCCTACTCTGTA KASP Assay Primer Common: CCATGGAAGAGCTCGAGATGCTAAT	T/T	Driskill et al. 2021 unpublished-SNP data	CHUM 1597 .001 PL	Not Available
MOLECULAR	HK 5441F_117067	KASP Assay Primer Allele X: GAAGCGGAGCTCGCCG KASP Assay Primer Allele Y: CCTGAAGCGGAGCTCGCCT KASP Assay Primer Common: TATCGGAGTTCTTATGGATTCCCTTTGAA	T/G	Driskill et al. 2021 unpublished-SNP data	CHUM 1597 .001 PL	Not Available
MOLECULAR	HK 5449F_211727	KASP Assay Primer Allele X: AGATGCAGCATTTGACAAATACAACAAA KASP Assay Primer Allele Y: GATGCAGCATTTGACAAATACAACAAC KASP Assay Primer Common: TCTAATGAGGGCACCTACMCCTATAAT	C/C	Driskill et al. 2021 unpublished-SNP data	CHUM 1597 .001 PL	Not Available