Details for: PI 684795, Humulus lupulus L. var. lupulus, New Zealand Seed Lot #3

Summary Data

Taxonomy:

Humulus lupulus L. var. lupulus

Top Name:

New Zealand Seed Lot #3

Origin:

Donated – South Island, New Zealand

Maintained:

National Clonal Germplasm Repository

Received by NPGS:

21 Jun 2005

Improvement Status:

Breeding material

Reproductive Uniformity:

Hybrid

Form Received:

Rhizome

Life Form:

Perennial

Life Cycle:

Perennial

Availability

This accession is not available. Contact site for status.

National Clonal Germplasm Repository

Due to a recent decrease in resources, we are in the process of restructuring our distribution and are not able to accept requests for this material at this time.

Images (1 total. Click on image for more.)

Core Passport Data

Taxonomy:

Humulus lupulus L. var. lupulus

Top Name:

New Zealand Seed Lot #3

Origin:

Donated – South Island, New Zealand

Maintained:

National Clonal Germplasm Repository

Received by NPGS:

21 Jun 2005

Improvement Status:

Breeding material

Reproductive Uniformity:

Hybrid

Form Received:

Rhizome

Life Form:

Perennial

Life Cycle:

Perennial

Source History

Donated

21 June 2005.
South Island, New Zealand

Donor(s):

Beatson, Ron A., Riwaka Research Station

Accession Names and Identifiers

New Zealand Seed Lot #3

Type: Site identifier

Group: SPECIES

accession preserved for genes

CHUM 1589

Type: Site identifier

Group: LOCAL

Corvallis local number

Narrative

The collection trip was part of an international apple genetics group who were surveying and collecting wild Malus spp from Central Asia (September 1993). The hops were found growing extensively in the area, for example climbing up and smothering wild apple trees 10m in height. The hops were found on the Northern side of the mountain range. The plants had large leaves and long cones (ca. 5cm long). During the visit the cones appeared to be ripe and were quite sticky and aromatic. Seeds were collected from 7 plants in 2 distinctly different regions of the Alatau.Upon entering the New Zealand quarantine facility in October 1993, the seed lots were stratified following protocols supplied by the HortResearch hop breeding programme staff. Only 5 lots of seed germinated. The original instructions were to grow 10 plants of each seed lot to ensure that both sexes were represented. They were found to have 'virus-like particles' as observed under EM. As per MAF Level 3 (closed quarantine) regulations, they were not released. No viruses/viroids were ever identified.

Humulus lupulus L. var. lupulus

Genus:

Humulus

Family:

Cannabaceae

Nomen number:

415440

Verified:

11/10/1999 by ARS Systematic Botanists.

Other conspecific taxa

Humulus lupulus L. (10 active accession[s])
Humulus lupulus L. var. cordifolius (Miq.) Maxim. (1 active accession[s])
Humulus lupulus L. var. lupuloides E. Small (143 active accession[s])
Humulus lupulus L. var. neomexicanus A. Nelson & Cockerell (96 active accession[s])
Humulus lupulus L. var. pubescens E. Small (10 active accession[s])

Autonyms (not in current use), synonyms and invalid designations

Common names

Language	Name	seq	Citation
English	common hop	1	Erhardt, W. et al. 2008. Der große Zander: Enzyklopädie der Pflanzennamen 1470.
English	European hop	1	Huxley, A., ed. 1992. The new Royal Horticultural Society dictionary of gardening
English	hop	1	Wiersema, J. H. & B. León. 1999. World economic plants: a standard reference CRC Press, Boca Raton, FL.
French	houblon	2	Rehm, S. 1994. Multilingual dictionary of agronomic plants
German	gewöhnlicher Hopfen	2	Erhardt, W. et al. 2008. Der große Zander: Enzyklopädie der Pflanzennamen 1470.
German	Hopfen	2	Rehm, S. 1994. Multilingual dictionary of agronomic plants
Portuguese	lúpulo	2	Rehm, S. 1994. Multilingual dictionary of agronomic plants
Portuguese (Brazil)	lúparo	2	Groth, D. 2005. pers. comm. Note: re. Brazilian common names
Portuguese (Brazil)	vinho-do-norte	2	Groth, D. 2005. pers. comm. Note: re. Brazilian common names
Spanish	lúpulo	2	Rehm, S. 1994. Multilingual dictionary of agronomic plants
Transcribed Chinese	pi jiu hua	2	Wu Zheng-yi & P. H. Raven et al., eds. 1994-. Flora of China (English edition).
Transcribed Korean	hop	2	Mun-Chan, B. et al. 1986. A checklist of the Korean cultivated plants. Kulturpflanze 34:103.

Annotations

Observations

Phenotype Data

Category	Descriptor	Description	Value	Study	Inventory	Availability
MOLECULAR	HI_AGA7	Motif: (CAT)3N3(CTT)9N3(CTT)3 F: ACAAGCAGTAATGATGAGGA R: TCCAAGTCTCTCAATTAGGAA	181:187	Driskill et al. 2021 unpublished-SSR data	CHUM 1589 .001 PL	Not Available
MOLECULAR	K10315842	Motif: (TGG)8 F: CTCAACTACCCTCTCGTCTG R: TAGCTGGAATGAGCGAAGTA	267	Driskill et al. 2021 unpublished-SSR data	CHUM 1589 .001 PL	Not Available
MOLECULAR	K10315910	Motif: (CTT)7 F: GATAGCCAATCTGGTATGGA R: GGGTAACGAAATCCCTAACT	369	Driskill et al. 2021 unpublished-SSR data	CHUM 1589 .001 PL	Not Available
MOLECULAR	K10316221 pig	Motif: (TCT)7 F: GTTGTTCTCTTCCAACCAAG Rp: GTTTCCAAAGAAGACCCATTACAG	137:146	Driskill et al. 2021 unpublished-SSR data	CHUM 1589 .001 PL	Not Available
MOLECULAR	Hop Primer 1	Motif: (CTT)n F: AACAAGCTCTGGTAATAACAACAT R: AAAACAAGAACCAGAGATAAGGAC	235	Driskill et al. 2021 unpublished-SSR data	CHUM 1589 .001 PL	Not Available
MOLECULAR	Hop Primer 6	Motif: T/A, GAA/TTC F: AAAGCGAAAACTCATGAAAAGGTT R: GACACATGTAAGGTGACCTTTACA	237	Driskill et al. 2021 unpublished-SSR data	CHUM 1589 .001 PL	Not Available
MOLECULAR	K10315931 pig	Motif: (CTT)7 F: TCTCCCTAAATGCTATTGTCA Rp: GTTTCGATCATTAGGGTTGAATC	309	Driskill et al. 2021 unpublished-SSR data	CHUM 1589 .001 PL	Not Available
MOLECULAR	K10316016	Motif: (AAT)5 F: TACAGGTGCAGTAGCTCAAA R: ATCAAGCTCCTCTAAACCCT	391	Driskill et al. 2021 unpublished-SSR data	CHUM 1589 .001 PL	Not Available
MOLECULAR	ACA1-K9-3	Motif: (TTC)17 F: ATCCTTCTCTCATTACATACTCAGC R: CCTATGACGGTTCTTATGAGTGC	195:199	Driskill et al. 2021 unpublished-SSR data	CHUM 1589 .001 PL	Not Available