Details for: PI 684779, Humulus lupulus L. var. lupulus, Serbian K-57

Summary Data

Taxonomy:

Humulus lupulus L. var. lupulus

Top Name:

Serbian K-57

Origin:

Developed – Serbia

Maintained:

National Clonal Germplasm Repository

Received by NPGS:

02 Apr 2008

Improvement Status:

Cultivar

Reproductive Uniformity:

Hybrid

Form Received:

Rhizome

Life Form:

Perennial

Life Cycle:

Perennial

Availability

This accession is not available. Contact site for status.

National Clonal Germplasm Repository

Due to a recent decrease in resources, we are in the process of restructuring our distribution and are not able to accept requests for this material at this time.

There are no images for this accession.

Core Passport Data

Taxonomy:

Humulus lupulus L. var. lupulus

Top Name:

Serbian K-57

Origin:

Developed – Serbia

Maintained:

National Clonal Germplasm Repository

Received by NPGS:

02 Apr 2008

Improvement Status:

Cultivar

Reproductive Uniformity:

Hybrid

Form Received:

Rhizome

Life Form:

Perennial

Life Cycle:

Perennial

Source History

Developed

02 April 2008.
Serbia

Accession Names and Identifiers

Serbian K-57

Type: Developer identifier

Group: HOPS

CHUM 1572

Type: Site identifier

Group: LOCAL

Corvallis local number

Narrative

Humulus lupulus L. var. lupulus

Genus:

Humulus

Family:

Cannabaceae

Nomen number:

415440

Verified:

11/10/1999 by ARS Systematic Botanists.

Other conspecific taxa

Humulus lupulus L. (10 active accession[s])
Humulus lupulus L. var. cordifolius (Miq.) Maxim. (1 active accession[s])
Humulus lupulus L. var. lupuloides E. Small (143 active accession[s])
Humulus lupulus L. var. neomexicanus A. Nelson & Cockerell (96 active accession[s])
Humulus lupulus L. var. pubescens E. Small (10 active accession[s])

Autonyms (not in current use), synonyms and invalid designations

Common names

Language	Name	seq	Citation
English	common hop	1	Erhardt, W. et al. 2008. Der große Zander: Enzyklopädie der Pflanzennamen 1470.
English	European hop	1	Huxley, A., ed. 1992. The new Royal Horticultural Society dictionary of gardening
English	hop	1	Wiersema, J. H. & B. León. 1999. World economic plants: a standard reference CRC Press, Boca Raton, FL.
French	houblon	2	Rehm, S. 1994. Multilingual dictionary of agronomic plants
German	gewöhnlicher Hopfen	2	Erhardt, W. et al. 2008. Der große Zander: Enzyklopädie der Pflanzennamen 1470.
German	Hopfen	2	Rehm, S. 1994. Multilingual dictionary of agronomic plants
Portuguese	lúpulo	2	Rehm, S. 1994. Multilingual dictionary of agronomic plants
Portuguese (Brazil)	lúparo	2	Groth, D. 2005. pers. comm. Note: re. Brazilian common names
Portuguese (Brazil)	vinho-do-norte	2	Groth, D. 2005. pers. comm. Note: re. Brazilian common names
Spanish	lúpulo	2	Rehm, S. 1994. Multilingual dictionary of agronomic plants
Transcribed Chinese	pi jiu hua	2	Wu Zheng-yi & P. H. Raven et al., eds. 1994-. Flora of China (English edition).
Transcribed Korean	hop	2	Mun-Chan, B. et al. 1986. A checklist of the Korean cultivated plants. Kulturpflanze 34:103.

Annotations

Observations

Phenotype Data

Category	Descriptor	Description	Value	Study	Inventory	Availability
MOLECULAR	HI_AGA7	Motif: (CAT)3N3(CTT)9N3(CTT)3 F: ACAAGCAGTAATGATGAGGA R: TCCAAGTCTCTCAATTAGGAA	206	Driskill et al. 2021 unpublished-SSR data	CHUM 1572 .001 PL	Not Available
MOLECULAR	K10315842	Motif: (TGG)8 F: CTCAACTACCCTCTCGTCTG R: TAGCTGGAATGAGCGAAGTA	267:285	Driskill et al. 2021 unpublished-SSR data	CHUM 1572 .001 PL	Not Available
MOLECULAR	K10315910	Motif: (CTT)7 F: GATAGCCAATCTGGTATGGA R: GGGTAACGAAATCCCTAACT	369	Driskill et al. 2021 unpublished-SSR data	CHUM 1572 .001 PL	Not Available
MOLECULAR	K10316221 pig	Motif: (TCT)7 F: GTTGTTCTCTTCCAACCAAG Rp: GTTTCCAAAGAAGACCCATTACAG	143:156	Driskill et al. 2021 unpublished-SSR data	CHUM 1572 .001 PL	Not Available
MOLECULAR	Hop Primer 1	Motif: (CTT)n F: AACAAGCTCTGGTAATAACAACAT R: AAAACAAGAACCAGAGATAAGGAC	250:253	Driskill et al. 2021 unpublished-SSR data	CHUM 1572 .001 PL	Not Available
MOLECULAR	Hop Primer 6	Motif: T/A, GAA/TTC F: AAAGCGAAAACTCATGAAAAGGTT R: GACACATGTAAGGTGACCTTTACA	249	Driskill et al. 2021 unpublished-SSR data	CHUM 1572 .001 PL	Not Available
MOLECULAR	K10315931 pig	Motif: (CTT)7 F: TCTCCCTAAATGCTATTGTCA Rp: GTTTCGATCATTAGGGTTGAATC	312	Driskill et al. 2021 unpublished-SSR data	CHUM 1572 .001 PL	Not Available
MOLECULAR	K10316016	Motif: (AAT)5 F: TACAGGTGCAGTAGCTCAAA R: ATCAAGCTCCTCTAAACCCT	391:397	Driskill et al. 2021 unpublished-SSR data	CHUM 1572 .001 PL	Not Available
MOLECULAR	ACA1-K9-3	Motif: (TTC)17 F: ATCCTTCTCTCATTACATACTCAGC R: CCTATGACGGTTCTTATGAGTGC	189:211	Driskill et al. 2021 unpublished-SSR data	CHUM 1572 .001 PL	Not Available