Details for: PI 684739, Humulus lupulus L. var. lupulus, 'Early Promise'

Summary Data

Taxonomy:

Humulus lupulus L. var. lupulus

Cultivar:

'Early Promise'

Origin:

Developed – England, United Kingdom

Maintained:

National Clonal Germplasm Repository

Received by NPGS:

02 Apr 2008

Improvement Status:

Cultivar

Reproductive Uniformity:

Hybrid

Form Received:

Rhizome

Life Form:

Perennial

Life Cycle:

Perennial

Availability

This accession is not available. Contact site for status.

National Clonal Germplasm Repository

There are no images for this accession.

Core Passport Data

Taxonomy:

Humulus lupulus L. var. lupulus

Cultivar:

'Early Promise'

Origin:

Developed – England, United Kingdom

Maintained:

National Clonal Germplasm Repository

Received by NPGS:

02 Apr 2008

Improvement Status:

Cultivar

Reproductive Uniformity:

Hybrid

Form Received:

Rhizome

Life Form:

Perennial

Life Cycle:

Perennial

Source History

Developed

England, United Kingdom

Donated

2008.
Serbia

Accession Names and Identifiers

'Early Promise'

Type: Cultivar name

Group: HOPS

'Earlybird Promise'

Type: Cultivar name

Group: HOPS

Received under this name

CHUM 1518

Type: Site identifier

Group: LOCAL

Corvallis local number

Narrative

Early Promise was selected at Wye College, England, most likely from an old English variety through mass selection. It was originally usee as an aroma hop in the US, its poor yield in its USDA Corvallis plot eventually led to its discontinuation as a commercial prospect. Like Early Prolific, Early Promise may be useful for breeding aroma hops with a continental-style aroma. Characteristics
Continental-style aroma
Purpose Aroma
Alpha Acid Composition 6.1%
Beta Acid Composition 1.7%
Co-Humulone Composition 30%
Country UK
Seasonal Maturity Early
Yield Amount 670-900 kg/hectare (600-800 lbs/acre)
Growth Rate Low to moderate
Resistant to Moderately resistant to downy mildew
Susceptible to Susceptible to powdery mildew
Total Oil Composition 0.5 mL/100g
Myrcene Oil Composition <42%
Humulene Oil Composition 18.4%

Humulus lupulus L. var. lupulus

Genus:

Humulus

Family:

Cannabaceae

Nomen number:

415440

Verified:

11/10/1999 by ARS Systematic Botanists.

Other conspecific taxa

Humulus lupulus L. (10 active accession[s])
Humulus lupulus L. var. cordifolius (Miq.) Maxim. (1 active accession[s])
Humulus lupulus L. var. lupuloides E. Small (143 active accession[s])
Humulus lupulus L. var. neomexicanus A. Nelson & Cockerell (96 active accession[s])
Humulus lupulus L. var. pubescens E. Small (10 active accession[s])

Autonyms (not in current use), synonyms and invalid designations

Common names

Language	Name	seq	Citation
English	common hop	1	Erhardt, W. et al. 2008. Der große Zander: Enzyklopädie der Pflanzennamen 1470.
English	European hop	1	Huxley, A., ed. 1992. The new Royal Horticultural Society dictionary of gardening
English	hop	1	Wiersema, J. H. & B. León. 1999. World economic plants: a standard reference CRC Press, Boca Raton, FL.
French	houblon	2	Rehm, S. 1994. Multilingual dictionary of agronomic plants
German	gewöhnlicher Hopfen	2	Erhardt, W. et al. 2008. Der große Zander: Enzyklopädie der Pflanzennamen 1470.
German	Hopfen	2	Rehm, S. 1994. Multilingual dictionary of agronomic plants
Portuguese	lúpulo	2	Rehm, S. 1994. Multilingual dictionary of agronomic plants
Portuguese (Brazil)	lúparo	2	Groth, D. 2005. pers. comm. Note: re. Brazilian common names
Portuguese (Brazil)	vinho-do-norte	2	Groth, D. 2005. pers. comm. Note: re. Brazilian common names
Spanish	lúpulo	2	Rehm, S. 1994. Multilingual dictionary of agronomic plants
Transcribed Chinese	pi jiu hua	2	Wu Zheng-yi & P. H. Raven et al., eds. 1994-. Flora of China (English edition).
Transcribed Korean	hop	2	Mun-Chan, B. et al. 1986. A checklist of the Korean cultivated plants. Kulturpflanze 34:103.

Annotations

Observations

Phenotype Data

Category	Descriptor	Description	Value	Study	Inventory	Availability
MOLECULAR	HI_AGA7	Motif: (CAT)3N3(CTT)9N3(CTT)3 F: ACAAGCAGTAATGATGAGGA R: TCCAAGTCTCTCAATTAGGAA	181	Driskill et al. 2021 unpublished-SSR data	CHUM 1518 .001 PL	Not Available
MOLECULAR	K10315842	Motif: (TGG)8 F: CTCAACTACCCTCTCGTCTG R: TAGCTGGAATGAGCGAAGTA	270	Driskill et al. 2021 unpublished-SSR data	CHUM 1518 .001 PL	Not Available
MOLECULAR	K10315910	Motif: (CTT)7 F: GATAGCCAATCTGGTATGGA R: GGGTAACGAAATCCCTAACT	369	Driskill et al. 2021 unpublished-SSR data	CHUM 1518 .001 PL	Not Available
MOLECULAR	K10316221 pig	Motif: (TCT)7 F: GTTGTTCTCTTCCAACCAAG Rp: GTTTCCAAAGAAGACCCATTACAG	140:156	Driskill et al. 2021 unpublished-SSR data	CHUM 1518 .001 PL	Not Available
MOLECULAR	Hop Primer 1	Motif: (CTT)n F: AACAAGCTCTGGTAATAACAACAT R: AAAACAAGAACCAGAGATAAGGAC	235	Driskill et al. 2021 unpublished-SSR data	CHUM 1518 .001 PL	Not Available
MOLECULAR	Hop Primer 6	Motif: T/A, GAA/TTC F: AAAGCGAAAACTCATGAAAAGGTT R: GACACATGTAAGGTGACCTTTACA	237:240	Driskill et al. 2021 unpublished-SSR data	CHUM 1518 .001 PL	Not Available
MOLECULAR	K10315931 pig	Motif: (CTT)7 F: TCTCCCTAAATGCTATTGTCA Rp: GTTTCGATCATTAGGGTTGAATC	312	Driskill et al. 2021 unpublished-SSR data	CHUM 1518 .001 PL	Not Available
MOLECULAR	K10316016	Motif: (AAT)5 F: TACAGGTGCAGTAGCTCAAA R: ATCAAGCTCCTCTAAACCCT	391	Driskill et al. 2021 unpublished-SSR data	CHUM 1518 .001 PL	Not Available
MOLECULAR	ACA1-K9-3	Motif: (TTC)17 F: ATCCTTCTCTCATTACATACTCAGC R: CCTATGACGGTTCTTATGAGTGC	174:211	Driskill et al. 2021 unpublished-SSR data	CHUM 1518 .001 PL	Not Available