Details for: PI 684732, Humulus lupulus L. var. lupulus, 'Hallertauer Magnum'

Summary Data

Taxonomy:

Humulus lupulus L. var. lupulus

Cultivar:

'Hallertauer Magnum'

Origin:

Developed – Germany

Maintained:

National Clonal Germplasm Repository

Received by NPGS:

02 Apr 2008

Improvement Status:

Cultivar

Reproductive Uniformity:

Hybrid

Form Received:

Rhizome

Life Form:

Perennial

Life Cycle:

Perennial

Availability

This accession is not available. Contact site for status.

National Clonal Germplasm Repository

Due to a recent decrease in resources, we are in the process of restructuring our distribution and are not able to accept requests for this material at this time.

There are no images for this accession.

Core Passport Data

Taxonomy:

Humulus lupulus L. var. lupulus

Cultivar:

'Hallertauer Magnum'

Origin:

Developed – Germany

Maintained:

National Clonal Germplasm Repository

Received by NPGS:

02 Apr 2008

Improvement Status:

Cultivar

Reproductive Uniformity:

Hybrid

Form Received:

Rhizome

Life Form:

Perennial

Life Cycle:

Perennial

Source History

Developed

1990.
Germany
Comment: from Huell

Accession Names and Identifiers

'Hallertauer Magnum'

Type: Cultivar name

Group: HOPS

'Magnum'

Type: Cultivar name

Group: HOPS

CHUM 1509

Type: Site identifier

Group: LOCAL

Corvallis local number

Narrative

USDA ACCESSION No.: 21670 SELECTION: no information, except that the male parent is 50% Hallertauer mf (USDA 56001 or 21014) GENUS: Humulus SPECIES: lupulus CULTIVAR: Hallertauer Magnum, also called Magnum PEDIGREE: Galena (USDA 21182) x German male hop Nr. 75/5/3 ORIGIN: German Hop Research Institute Huell, Germany METHOD RECEIVED: rhizomes REFERENCES: Annual Report for USDA Hop Research 1992 and later years German Society for Hop Research Annual reports starting in the 1980's MATURITY: medium to medium late LEAF COLOR: medium dark green SEX: female DISEASES: Downy mildew: resistant to moderately resistant Verticillium wild: resistant Powdery mildew: susceptible Viruses: free of all 5 major hop viruses at time of receipt VIGOR: very good YIELD: very good SIDE ARM LENGTH: 20 to 40 inches ALPHA ACIDS: 12 to 17% BETA ACIDS: 5 to 6% COHUMULONE: 26 to 28% STORAGE STABILITY: good to very good, retained over 90% of original alpha acids after 6 months storage at room temperature OIL: 2.33 ml/100 g (4 year range: 1.2 to 3.7 ml/100 g); myrcene 60.5%; humulene 18.5%; caryophyllene 4.1%; farnesene trace; H/C ratio = 3.50 MAJOR TRAITS: very high alpha acids content; good storge stability, low cohumulone content, very good yield potential OTHER INFORMATION: Very large cones that tend to break up and shatter during picking. Some tendency to form angel cones (small leaflets in the cone which drives up leaf and stem data. The hop is a diploid, 2n= 20. This hop is the major high-alpha hop in Germany and is rapidly becoming the most widely grown hop in that country.

Humulus lupulus L. var. lupulus

Genus:

Humulus

Family:

Cannabaceae

Nomen number:

415440

Verified:

11/10/1999 by ARS Systematic Botanists.

Other conspecific taxa

Humulus lupulus L. (10 active accession[s])
Humulus lupulus L. var. cordifolius (Miq.) Maxim. (1 active accession[s])
Humulus lupulus L. var. lupuloides E. Small (143 active accession[s])
Humulus lupulus L. var. neomexicanus A. Nelson & Cockerell (96 active accession[s])
Humulus lupulus L. var. pubescens E. Small (10 active accession[s])

Autonyms (not in current use), synonyms and invalid designations

Common names

Language	Name	seq	Citation
English	common hop	1	Erhardt, W. et al. 2008. Der große Zander: Enzyklopädie der Pflanzennamen 1470.
English	European hop	1	Huxley, A., ed. 1992. The new Royal Horticultural Society dictionary of gardening
English	hop	1	Wiersema, J. H. & B. León. 1999. World economic plants: a standard reference CRC Press, Boca Raton, FL.
French	houblon	2	Rehm, S. 1994. Multilingual dictionary of agronomic plants
German	gewöhnlicher Hopfen	2	Erhardt, W. et al. 2008. Der große Zander: Enzyklopädie der Pflanzennamen 1470.
German	Hopfen	2	Rehm, S. 1994. Multilingual dictionary of agronomic plants
Portuguese	lúpulo	2	Rehm, S. 1994. Multilingual dictionary of agronomic plants
Portuguese (Brazil)	lúparo	2	Groth, D. 2005. pers. comm. Note: re. Brazilian common names
Portuguese (Brazil)	vinho-do-norte	2	Groth, D. 2005. pers. comm. Note: re. Brazilian common names
Spanish	lúpulo	2	Rehm, S. 1994. Multilingual dictionary of agronomic plants
Transcribed Chinese	pi jiu hua	2	Wu Zheng-yi & P. H. Raven et al., eds. 1994-. Flora of China (English edition).
Transcribed Korean	hop	2	Mun-Chan, B. et al. 1986. A checklist of the Korean cultivated plants. Kulturpflanze 34:103.

Annotations

Observations

Phenotype Data

Category	Descriptor	Description	Value	Study	Inventory	Availability
MOLECULAR	HI_AGA7	Motif: (CAT)3N3(CTT)9N3(CTT)3 F: ACAAGCAGTAATGATGAGGA R: TCCAAGTCTCTCAATTAGGAA	181:209	Driskill et al. 2021 unpublished-SSR data	CHUM 1509 .001 PL	Not Available
MOLECULAR	K10315842	Motif: (TGG)8 F: CTCAACTACCCTCTCGTCTG R: TAGCTGGAATGAGCGAAGTA	267:285	Driskill et al. 2021 unpublished-SSR data	CHUM 1509 .001 PL	Not Available
MOLECULAR	K10315910	Motif: (CTT)7 F: GATAGCCAATCTGGTATGGA R: GGGTAACGAAATCCCTAACT	359:369	Driskill et al. 2021 unpublished-SSR data	CHUM 1509 .001 PL	Not Available
MOLECULAR	K10316221 pig	Motif: (TCT)7 F: GTTGTTCTCTTCCAACCAAG Rp: GTTTCCAAAGAAGACCCATTACAG	156	Driskill et al. 2021 unpublished-SSR data	CHUM 1509 .001 PL	Not Available
MOLECULAR	Hop Primer 1	Motif: (CTT)n F: AACAAGCTCTGGTAATAACAACAT R: AAAACAAGAACCAGAGATAAGGAC	250:253	Driskill et al. 2021 unpublished-SSR data	CHUM 1509 .001 PL	Not Available
MOLECULAR	Hop Primer 6	Motif: T/A, GAA/TTC F: AAAGCGAAAACTCATGAAAAGGTT R: GACACATGTAAGGTGACCTTTACA	237:240	Driskill et al. 2021 unpublished-SSR data	CHUM 1509 .001 PL	Not Available
MOLECULAR	K10315931 pig	Motif: (CTT)7 F: TCTCCCTAAATGCTATTGTCA Rp: GTTTCGATCATTAGGGTTGAATC	304:312	Driskill et al. 2021 unpublished-SSR data	CHUM 1509 .001 PL	Not Available
MOLECULAR	K10316016	Motif: (AAT)5 F: TACAGGTGCAGTAGCTCAAA R: ATCAAGCTCCTCTAAACCCT	391:397	Driskill et al. 2021 unpublished-SSR data	CHUM 1509 .001 PL	Not Available
MOLECULAR	ACA1-K9-3	Motif: (TTC)17 F: ATCCTTCTCTCATTACATACTCAGC R: CCTATGACGGTTCTTATGAGTGC	211	Driskill et al. 2021 unpublished-SSR data	CHUM 1509 .001 PL	Not Available