Details for: PI 684715, Humulus lupulus L. var. lupulus, 'Cekin'

Summary Data

Taxonomy:

Humulus lupulus L. var. lupulus

Cultivar:

'Cekin'

Origin:

Developed – Slovenia

Maintained:

National Clonal Germplasm Repository

Received by NPGS:

02 Apr 2008

Improvement Status:

Cultivar

Reproductive Uniformity:

Hybrid

Form Received:

Rhizome

Life Form:

Perennial

Life Cycle:

Perennial

Availability

This accession is not available. Contact site for status.

National Clonal Germplasm Repository

Due to a recent decrease in resources, we are in the process of restructuring our distribution and are not able to accept requests for this material at this time.

There are no images for this accession.

Core Passport Data

Taxonomy:

Humulus lupulus L. var. lupulus

Cultivar:

'Cekin'

Origin:

Developed – Slovenia

Maintained:

National Clonal Germplasm Repository

Received by NPGS:

02 Apr 2008

Improvement Status:

Cultivar

Reproductive Uniformity:

Hybrid

Form Received:

Rhizome

Life Form:

Perennial

Life Cycle:

Perennial

Source History

Developed

1970.
Slovenia

Donated

2008.
Serbia

Accession Names and Identifiers

'Cekin'

Type: Cultivar name

Group: HOPS

CHUM 1489

Type: Site identifier

Group: LOCAL

Corvallis local number

Narrative

SELECTION: seedling selection from a cross made by Dr. Dragica Kralj Hop Research Institute Zalec in the 1980s GENUS: Humulus SPECIES: lupulus CULTIVAR: Cekin PEDIGREE: Aurora x tetraploid Yugoslav male 3/3; (USDA 21053 x tetraploid USDA 21087M) PRIMARY SITE: USDA-OSU Experimental Hop Farm, East Farm, Corvallis ORIGIN: seedling selection DATE RECEIVED: spring 1990 METHOD RECEIVED: rhizomes AVAILBILITY: no restrictions, commercial variety REFERENCES: Various USDA Annual Reports for Hop Research starting In 1990. Kralj, Dragica. 1990. New Hop Varieties: Cerera, Celeia, Cekin, and Cicero. Chmeljar, March 1990. MATURITY: medium late to late LEAF COLOR: dark green SEX: female DISEASES: downy mildew: moderately resistant Verticillium wilt: no information Viruses: no information VIGOR: good in Slovenia, only fair in Corvallis test plots YIELD: good in Slovenia, poor in Corvallis test plots SIDE ARM LENGTH: 12 to 20 inches ALPHA ACIDS: 6 to 8% BETA ACIDS: 2 to 3% COHUMULONE: 24% STORAGE STABILITY: very good, retained 79% of original alpha acids after 6 months room temperature storage OIL: 1.07 ml/100 g. Humulene 16.5%; caryophyllene 6.2%; myrcene 47.9%; farnesene 7.1%. H/C ratio = 2.62 MAJOR TRAITS: pleasant continental aroma similar to Styrian (USDA 21049) hop OTHER INFORMATION: triploid 2n = 30; this hop is a sister to USDA 21614, Cicero It is only grown in limited quantities because of lack of brewer acceptance.

Humulus lupulus L. var. lupulus

Genus:

Humulus

Family:

Cannabaceae

Nomen number:

415440

Verified:

11/10/1999 by ARS Systematic Botanists.

Other conspecific taxa

Humulus lupulus L. (10 active accession[s])
Humulus lupulus L. var. cordifolius (Miq.) Maxim. (1 active accession[s])
Humulus lupulus L. var. lupuloides E. Small (143 active accession[s])
Humulus lupulus L. var. neomexicanus A. Nelson & Cockerell (96 active accession[s])
Humulus lupulus L. var. pubescens E. Small (10 active accession[s])

Autonyms (not in current use), synonyms and invalid designations

Common names

Language	Name	seq	Citation
English	common hop	1	Erhardt, W. et al. 2008. Der große Zander: Enzyklopädie der Pflanzennamen 1470.
English	European hop	1	Huxley, A., ed. 1992. The new Royal Horticultural Society dictionary of gardening
English	hop	1	Wiersema, J. H. & B. León. 1999. World economic plants: a standard reference CRC Press, Boca Raton, FL.
French	houblon	2	Rehm, S. 1994. Multilingual dictionary of agronomic plants
German	gewöhnlicher Hopfen	2	Erhardt, W. et al. 2008. Der große Zander: Enzyklopädie der Pflanzennamen 1470.
German	Hopfen	2	Rehm, S. 1994. Multilingual dictionary of agronomic plants
Portuguese	lúpulo	2	Rehm, S. 1994. Multilingual dictionary of agronomic plants
Portuguese (Brazil)	lúparo	2	Groth, D. 2005. pers. comm. Note: re. Brazilian common names
Portuguese (Brazil)	vinho-do-norte	2	Groth, D. 2005. pers. comm. Note: re. Brazilian common names
Spanish	lúpulo	2	Rehm, S. 1994. Multilingual dictionary of agronomic plants
Transcribed Chinese	pi jiu hua	2	Wu Zheng-yi & P. H. Raven et al., eds. 1994-. Flora of China (English edition).
Transcribed Korean	hop	2	Mun-Chan, B. et al. 1986. A checklist of the Korean cultivated plants. Kulturpflanze 34:103.

Annotations

Observations

Phenotype Data

Category	Descriptor	Description	Value	Study	Inventory	Availability
MOLECULAR	HI_AGA7	Motif: (CAT)3N3(CTT)9N3(CTT)3 F: ACAAGCAGTAATGATGAGGA R: TCCAAGTCTCTCAATTAGGAA	181:209	Driskill et al. 2021 unpublished-SSR data	CHUM 1489 .001 PL	Not Available
MOLECULAR	K10315842	Motif: (TGG)8 F: CTCAACTACCCTCTCGTCTG R: TAGCTGGAATGAGCGAAGTA	270:285	Driskill et al. 2021 unpublished-SSR data	CHUM 1489 .001 PL	Not Available
MOLECULAR	K10315910	Motif: (CTT)7 F: GATAGCCAATCTGGTATGGA R: GGGTAACGAAATCCCTAACT	369	Driskill et al. 2021 unpublished-SSR data	CHUM 1489 .001 PL	Not Available
MOLECULAR	K10316221 pig	Motif: (TCT)7 F: GTTGTTCTCTTCCAACCAAG Rp: GTTTCCAAAGAAGACCCATTACAG	140:156	Driskill et al. 2021 unpublished-SSR data	CHUM 1489 .001 PL	Not Available
MOLECULAR	Hop Primer 1	Motif: (CTT)n F: AACAAGCTCTGGTAATAACAACAT R: AAAACAAGAACCAGAGATAAGGAC	235:250	Driskill et al. 2021 unpublished-SSR data	CHUM 1489 .001 PL	Not Available
MOLECULAR	Hop Primer 6	Motif: T/A, GAA/TTC F: AAAGCGAAAACTCATGAAAAGGTT R: GACACATGTAAGGTGACCTTTACA	237:249	Driskill et al. 2021 unpublished-SSR data	CHUM 1489 .001 PL	Not Available
MOLECULAR	K10315931 pig	Motif: (CTT)7 F: TCTCCCTAAATGCTATTGTCA Rp: GTTTCGATCATTAGGGTTGAATC	312	Driskill et al. 2021 unpublished-SSR data	CHUM 1489 .001 PL	Not Available
MOLECULAR	K10316016	Motif: (AAT)5 F: TACAGGTGCAGTAGCTCAAA R: ATCAAGCTCCTCTAAACCCT	391:397	Driskill et al. 2021 unpublished-SSR data	CHUM 1489 .001 PL	Not Available
MOLECULAR	ACA1-K9-3	Motif: (TTC)17 F: ATCCTTCTCTCATTACATACTCAGC R: CCTATGACGGTTCTTATGAGTGC	174:211	Driskill et al. 2021 unpublished-SSR data	CHUM 1489 .001 PL	Not Available