Details for: PI 617403, Humulus lupulus L. var. lupulus, 'Sorachi Ace'

Summary Data

Taxonomy:

Humulus lupulus L. var. lupulus

Cultivar:

'Sorachi Ace'

Origin:

Donated – Oregon, United States

Maintained:

National Clonal Germplasm Repository

Received by NPGS:

16 Nov 1997

Improvement Status:

Cultivar

Reproductive Uniformity:

Hybrid

Form Received:

Plant

Life Form:

Perennial

Life Cycle:

Perennial

Availability

This accession is not available. Contact site for status.

National Clonal Germplasm Repository

Due to a recent decrease in resources, we are in the process of restructuring our distribution and are not able to accept requests for this material at this time.

Images (1 total. Click on image for more.)

Core Passport Data

Taxonomy:

Humulus lupulus L. var. lupulus

Cultivar:

'Sorachi Ace'

Origin:

Donated – Oregon, United States

Maintained:

National Clonal Germplasm Repository

Received by NPGS:

16 Nov 1997

Improvement Status:

Cultivar

Reproductive Uniformity:

Hybrid

Form Received:

Plant

Life Form:

Perennial

Life Cycle:

Perennial

Source History

Donated

17 November 1997.
Oregon, United States

Donor(s):

Henning, John A., USDA, ARS, NFSPRC

Accession Names and Identifiers

'Sorachi Ace'

Type: Cultivar name

Group: HOPS

USDA 21702

Type: Site identifier

Group: OTHERNUM

other identifier

CHUM 931

Type: Site identifier

Group: LOCAL

Corvallis local number

Narrative

USDA ACCESSION No.: 21702

SELECTION: seedling selection made in Japan

GENUS: Humulus

SPECIES: lupulus

CULTIVAR: Sorachi Ace

PEDIGREE: (Brewer's Gold x Saazer -OP) x Beikei No. 2 male

Note: The female parent is the Japanese seedling 70K-SH6 (USDA 21233) which was develioped by Dr. Mori sor Sapporo Breweries Co. Ltd.

PRIMARY SITE USDA/OSU Hop Research Farm, Corvallis, OR. 97330

ORIGIN: Sapporo Breweries Ltd., Tokyo 150 , Japan

DATE RECEIVED: spring 1994

METHOD RECEIVED: rhizomes

AVAILBILITY: no restrictions

REFERENCES: USDA/ARS Annual Report for Hop Research 1994, and later years

Mori, Yoshitada, 1988. Development of new hop varieties (Furano Ace and Sorachi Ace) of aroma- type in Japan. Sapporo Breweries Co. Ltd. , March 1988.

MATURITY: midseason

LEAF COLOR: dark green

SEX: female

DISEASES: Downy mildew: resistant (also resistant to botrytis)

Powdery mildew: no information

Verticillium wilt: no information

Virsues: No information

VIGOR: good

YIELD: fair to good, reportedly very good in Japan ( 8 - 10 bales/acre)

SIDE ARM LENGTH: 12 - 36 inches

ALPHA ACIDS: very high, reportedly up to 16% in Japan, but significantly lower in USDA test plots.

BETA ACIDS: non information

COHUMULONE: 23%

STORAGE STABILITY: no information

OIL: no information

MAJOR TRAITS: high yield potential; pleasant European aroma characteristics; high alpha acids potential

OTHER INFORMATION: Reportedly grown for several years at a Sapporo Breweries Hop Farm in China and exported to Japan and other countries. According to recent reports this hop is no longer grown commercially.

Humulus lupulus L. var. lupulus

Genus:

Humulus

Family:

Cannabaceae

Nomen number:

415440

Verified:

11/10/1999 by ARS Systematic Botanists.

Other conspecific taxa

Humulus lupulus L. (10 active accession[s])
Humulus lupulus L. var. cordifolius (Miq.) Maxim. (1 active accession[s])
Humulus lupulus L. var. lupuloides E. Small (143 active accession[s])
Humulus lupulus L. var. neomexicanus A. Nelson & Cockerell (96 active accession[s])
Humulus lupulus L. var. pubescens E. Small (10 active accession[s])

Autonyms (not in current use), synonyms and invalid designations

Common names

Language	Name	seq	Citation
English	common hop	1	Erhardt, W. et al. 2008. Der große Zander: Enzyklopädie der Pflanzennamen 1470.
English	European hop	1	Huxley, A., ed. 1992. The new Royal Horticultural Society dictionary of gardening
English	hop	1	Wiersema, J. H. & B. León. 1999. World economic plants: a standard reference CRC Press, Boca Raton, FL.
French	houblon	2	Rehm, S. 1994. Multilingual dictionary of agronomic plants
German	gewöhnlicher Hopfen	2	Erhardt, W. et al. 2008. Der große Zander: Enzyklopädie der Pflanzennamen 1470.
German	Hopfen	2	Rehm, S. 1994. Multilingual dictionary of agronomic plants
Portuguese	lúpulo	2	Rehm, S. 1994. Multilingual dictionary of agronomic plants
Portuguese (Brazil)	lúparo	2	Groth, D. 2005. pers. comm. Note: re. Brazilian common names
Portuguese (Brazil)	vinho-do-norte	2	Groth, D. 2005. pers. comm. Note: re. Brazilian common names
Spanish	lúpulo	2	Rehm, S. 1994. Multilingual dictionary of agronomic plants
Transcribed Chinese	pi jiu hua	2	Wu Zheng-yi & P. H. Raven et al., eds. 1994-. Flora of China (English edition).
Transcribed Korean	hop	2	Mun-Chan, B. et al. 1986. A checklist of the Korean cultivated plants. Kulturpflanze 34:103.

Annotations

Taxonomic Re-Identification: 31 Oct 2010, from Humulus lupulus L. to Humulus lupulus L. var. lupulus

Observations

Phenotype Data

Category	Descriptor	Description	Value	Study	Inventory	Availability
MOLECULAR	HI_AGA7	Motif: (CAT)3N3(CTT)9N3(CTT)3 F: ACAAGCAGTAATGATGAGGA R: TCCAAGTCTCTCAATTAGGAA	181:209	Driskill et al. 2021 unpublished-SSR data	CHUM 931 .003 PL	Not Available
MOLECULAR	K10315842	Motif: (TGG)8 F: CTCAACTACCCTCTCGTCTG R: TAGCTGGAATGAGCGAAGTA	270	Driskill et al. 2021 unpublished-SSR data	CHUM 931 .003 PL	Not Available
MOLECULAR	K10315910	Motif: (CTT)7 F: GATAGCCAATCTGGTATGGA R: GGGTAACGAAATCCCTAACT	369	Driskill et al. 2021 unpublished-SSR data	CHUM 931 .003 PL	Not Available
MOLECULAR	K10316221 pig	Motif: (TCT)7 F: GTTGTTCTCTTCCAACCAAG Rp: GTTTCCAAAGAAGACCCATTACAG	125:159	Driskill et al. 2021 unpublished-SSR data	CHUM 931 .003 PL	Not Available
MOLECULAR	Hop Primer 1	Motif: (CTT)n F: AACAAGCTCTGGTAATAACAACAT R: AAAACAAGAACCAGAGATAAGGAC	232:235	Driskill et al. 2021 unpublished-SSR data	CHUM 931 .003 PL	Not Available
MOLECULAR	Hop Primer 6	Motif: T/A, GAA/TTC F: AAAGCGAAAACTCATGAAAAGGTT R: GACACATGTAAGGTGACCTTTACA	237:240	Driskill et al. 2021 unpublished-SSR data	CHUM 931 .003 PL	Not Available
MOLECULAR	K10315931 pig	Motif: (CTT)7 F: TCTCCCTAAATGCTATTGTCA Rp: GTTTCGATCATTAGGGTTGAATC	304:312	Driskill et al. 2021 unpublished-SSR data	CHUM 931 .003 PL	Not Available
MOLECULAR	K10316016	Motif: (AAT)5 F: TACAGGTGCAGTAGCTCAAA R: ATCAAGCTCCTCTAAACCCT	391	Driskill et al. 2021 unpublished-SSR data	CHUM 931 .003 PL	Not Available
MOLECULAR	ACA1-K9-3	Motif: (TTC)17 F: ATCCTTCTCTCATTACATACTCAGC R: CCTATGACGGTTCTTATGAGTGC	165:217	Driskill et al. 2021 unpublished-SSR data	CHUM 931 .003 PL	Not Available