Details for: PI 558774, Humulus lupulus L. var. lupulus, 'SuperAlpha'

Summary Data

Taxonomy:

Humulus lupulus L. var. lupulus

Cultivar:

'SuperAlpha'

Origin:

Developed – South Island, New Zealand

Maintained:

National Clonal Germplasm Repository

Received by NPGS:

04 Dec 1991

Improvement Status:

Cultivar

Reproductive Uniformity:

Hybrid

Form Received:

Plant

Life Form:

Perennial

Life Cycle:

Perennial

Backup Location:

National Laboratory for Genetic Resources Preservation

Availability

This accession is not available. Contact site for status.

National Clonal Germplasm Repository

Due to a recent decrease in resources, we are in the process of restructuring our distribution and are not able to accept requests for this material at this time.

There are no images for this accession.

Core Passport Data

Taxonomy:

Humulus lupulus L. var. lupulus

Cultivar:

'SuperAlpha'

Origin:

Developed – South Island, New Zealand

Maintained:

National Clonal Germplasm Repository

Received by NPGS:

04 Dec 1991

Improvement Status:

Cultivar

Reproductive Uniformity:

Hybrid

Form Received:

Plant

Life Form:

Perennial

Life Cycle:

Perennial

Source History

Developed

1970.
South Island, New Zealand
Comment: Selected in the late 1970's.
Developer(s):

Frost, Tony, Riwaka Research Station

Donated

15 December 1983.
South Island, New Zealand
Comment: Selected in the late 1970's.
Donor(s):

Haunold, Alfred, USDA, ARS

Accession Names and Identifiers

'SuperAlpha'

Type: Cultivar name

Group: HOPS

USDA 21405

Type: Site identifier

Group: OTHERNUM

other identifier

CHUM 626

Type: Site identifier

Group: LOCAL

Corvallis local number

PHUM 626

Type: Inventory

Narrative

SuperAlpha is an open pollinated seedling selection from a tetraploid Smooth Cone made at the Riwaka Research Station near Nelson, New Zealand in the late 1970's by Mr. Tony Frost.
References: USDA ARS Annual Report of Hop Investigations for 1983, pp. 27-28.
Haunold, A. 1981. Foreign Travel Report for 1981. pp. 200-213.
Beatson, R. A. and J. F. Rohrbach. Annual Report of Hop research activities in New Zealand, 1985 and subsequent years. Riwaka Research Station, Motueka, New Zealand.

Maturity: Late
Leaf Color: Dark green
Sex: Female
Diseases: moderately resistant to downy mildew; unknown, probably resistant to Verticillium wilt
Viruses: free of major hop viruses
Vigor: very good
Yield: Fair to good near Corvallis, 6-year average 1203 lb/acre (range 1000 to 1800 lbs/acre); substantially higher in New Zealand
Sidearm length : no data
Alpha Acids : 10.4% (6-year range 9.5-12.7%)
Beta Acids: 5.4% (6-year range 3.6-7.0%
Cohumulone: 36%
Storage stability: very good, retained 79% of original alpha acids after 6 months room temperature storage
Oil: 1.25 ml/100 g (6-year range 0.6 - 1.4 ml)
Major traits: high yield potential; High alpha acids potential , particularly in New Zealand up to 15%; H/C = 3.34 Humulene 16.7% very high in myrcene, no farnesene
Other Information: Grown on significant acreage in New Zealand because of its high alpha potential good yields both for domestic consumption and exports.

Humulus lupulus L. var. lupulus

Genus:

Humulus

Family:

Cannabaceae

Nomen number:

415440

Verified:

11/10/1999 by ARS Systematic Botanists.

Other conspecific taxa

Humulus lupulus L. (10 active accession[s])
Humulus lupulus L. var. cordifolius (Miq.) Maxim. (1 active accession[s])
Humulus lupulus L. var. lupuloides E. Small (143 active accession[s])
Humulus lupulus L. var. neomexicanus A. Nelson & Cockerell (96 active accession[s])
Humulus lupulus L. var. pubescens E. Small (10 active accession[s])

Autonyms (not in current use), synonyms and invalid designations

Common names

Language	Name	seq	Citation
English	common hop	1	Erhardt, W. et al. 2008. Der große Zander: Enzyklopädie der Pflanzennamen 1470.
English	European hop	1	Huxley, A., ed. 1992. The new Royal Horticultural Society dictionary of gardening
English	hop	1	Wiersema, J. H. & B. León. 1999. World economic plants: a standard reference CRC Press, Boca Raton, FL.
French	houblon	2	Rehm, S. 1994. Multilingual dictionary of agronomic plants
German	gewöhnlicher Hopfen	2	Erhardt, W. et al. 2008. Der große Zander: Enzyklopädie der Pflanzennamen 1470.
German	Hopfen	2	Rehm, S. 1994. Multilingual dictionary of agronomic plants
Portuguese	lúpulo	2	Rehm, S. 1994. Multilingual dictionary of agronomic plants
Portuguese (Brazil)	lúparo	2	Groth, D. 2005. pers. comm. Note: re. Brazilian common names
Portuguese (Brazil)	vinho-do-norte	2	Groth, D. 2005. pers. comm. Note: re. Brazilian common names
Spanish	lúpulo	2	Rehm, S. 1994. Multilingual dictionary of agronomic plants
Transcribed Chinese	pi jiu hua	2	Wu Zheng-yi & P. H. Raven et al., eds. 1994-. Flora of China (English edition).
Transcribed Korean	hop	2	Mun-Chan, B. et al. 1986. A checklist of the Korean cultivated plants. Kulturpflanze 34:103.

Annotations

Taxonomic Re-Identification: 31 Oct 2010, from Humulus lupulus L. to Humulus lupulus L. var. lupulus

Observations

Phenotype Data

Category	Descriptor	Description	Value	Study	Inventory	Availability
GENSTOCK	HUMULUS CORE SUBSET	A flag to indicate the accession is part of the core subset	Yes	HUMULUS.CORE.1998		Not Available
MOLECULAR	HI_AGA7	Motif: (CAT)3N3(CTT)9N3(CTT)3 F: ACAAGCAGTAATGATGAGGA R: TCCAAGTCTCTCAATTAGGAA	172:181	Driskill et al. 2021 unpublished-SSR data	CHUM 626 .002 PL	Not Available
MOLECULAR	K10315842	Motif: (TGG)8 F: CTCAACTACCCTCTCGTCTG R: TAGCTGGAATGAGCGAAGTA	267:270:279	Driskill et al. 2021 unpublished-SSR data	CHUM 626 .002 PL	Not Available
MOLECULAR	K10315910	Motif: (CTT)7 F: GATAGCCAATCTGGTATGGA R: GGGTAACGAAATCCCTAACT	359:369	Driskill et al. 2021 unpublished-SSR data	CHUM 626 .002 PL	Not Available
MOLECULAR	K10316221 pig	Motif: (TCT)7 F: GTTGTTCTCTTCCAACCAAG Rp: GTTTCCAAAGAAGACCCATTACAG	140:156	Driskill et al. 2021 unpublished-SSR data	CHUM 626 .002 PL	Not Available
MOLECULAR	Hop Primer 1	Motif: (CTT)n F: AACAAGCTCTGGTAATAACAACAT R: AAAACAAGAACCAGAGATAAGGAC	235:250	Driskill et al. 2021 unpublished-SSR data	CHUM 626 .002 PL	Not Available
MOLECULAR	Hop Primer 6	Motif: T/A, GAA/TTC F: AAAGCGAAAACTCATGAAAAGGTT R: GACACATGTAAGGTGACCTTTACA	237	Driskill et al. 2021 unpublished-SSR data	CHUM 626 .002 PL	Not Available
MOLECULAR	K10315931 pig	Motif: (CTT)7 F: TCTCCCTAAATGCTATTGTCA Rp: GTTTCGATCATTAGGGTTGAATC	303:312	Driskill et al. 2021 unpublished-SSR data	CHUM 626 .002 PL	Not Available
MOLECULAR	K10316016	Motif: (AAT)5 F: TACAGGTGCAGTAGCTCAAA R: ATCAAGCTCCTCTAAACCCT	391:397	Driskill et al. 2021 unpublished-SSR data	CHUM 626 .002 PL	Not Available
MOLECULAR	ACA1-K9-3	Motif: (TTC)17 F: ATCCTTCTCTCATTACATACTCAGC R: CCTATGACGGTTCTTATGAGTGC	174:211	Driskill et al. 2021 unpublished-SSR data	CHUM 626 .002 PL	Not Available