Details for: PI 558759, Humulus lupulus L. var. lupulus, 'Banner'

Summary Data

Taxonomy:

Humulus lupulus L. var. lupulus

Cultivar:

'Banner'

Origin:

Developed – Idaho, United States

Maintained:

National Clonal Germplasm Repository

Received by NPGS:

04 Dec 1991

Improvement Status:

Cultivar

Reproductive Uniformity:

Hybrid

Form Received:

Rhizome

Life Form:

Perennial

Life Cycle:

Perennial

Availability

This accession is not available. Contact site for status.

National Clonal Germplasm Repository

Due to a recent decrease in resources, we are in the process of restructuring our distribution and are not able to accept requests for this material at this time.

There are no images for this accession.

Core Passport Data

Taxonomy:

Humulus lupulus L. var. lupulus

Cultivar:

'Banner'

Origin:

Developed – Idaho, United States

Maintained:

National Clonal Germplasm Repository

Received by NPGS:

04 Dec 1991

Improvement Status:

Cultivar

Reproductive Uniformity:

Hybrid

Form Received:

Rhizome

Life Form:

Perennial

Life Cycle:

Perennial

Source History

Developed

Idaho, United States
Comment: Selected by Romanko in early 1970's.
Developer(s):

Romanko, R.R., University of Idaho

Donated

04 December 1991.
Oregon, United States

Donor(s):

Haunold, Alfred, USDA, ARS

Accession Names and Identifiers

'Banner'

Type: Cultivar name

Group: HOPS

USDA 21287

Type: Site identifier

Group: OTHERNUM

other identifier

CHUM 611

Type: Site identifier

Group: LOCAL

Corvallis local number

PHUM 611

Type: Inventory

Narrative

Cultivar Synonym= USDA 21287, Seedling selection I43-11

USDA ACCESSION NO.: 21287

SELECTION: Selected in the early 1970's by Dr. R.R. Romanko at Parma, Idaho, as Sel No. I 43-11

GENUS: Humulus

SPECIES: lupulus

CULTIVAR: Banner

PEDIGREE: Open pollinated seedling of Brewer's Gold (USDA 19001)

PRIMARY SITE: USDA-ARS World Hop Cultivar Collection, Corvallis, Oregon, OSU East Farm

ORIGIN: Seedling selection I 43-11

DATE RECEIVED: Spring 1981

METHOD RECEIVED: Rhizomes

AVAILABILITY: No restrictions

REFERENCES: USDA-ARS Annual Report of Hop Investigations for 1981, p. 30.

Haunold, A. Annual Report to the Hop Research Council for 1988, p. 6.

Romanko, R.R., G.B.Nickerson, J. Jaeger, S.T. Kenny, and C.B.Skotland Registration of Banner Hop. Crop Science 36: 1417. 1996.

MATURITY: Medium early

LEAF COLOR: Light green

SEX: Female

DISEASES: Downy Mildew: susceptible

Verticillium wilt: moderately resistant

Viruses: unknown

VIGOR: Good to very good

YIELD: Very good (5-year average in Oregon 2175 lbs/acre in

nursery plots; about 1800 lbs/acre in commercial 4-acre plot)

SIDEARM LENGTH: 12-30 inches

ALPHA ACIDS: 11.1% (5-year range 8.4 to 13.0%)

BETA ACIDS: 6.5% (5-year range 5.3 to 8.0%)

COHUMULONE: 34%

STORAGE STABILITY: Poor, retained 43% of original alpha acids after 6 months room temperature storage.

OIL: 2.17 ml/100 g. Humulene 11.8%; caryophyllene 7.7%; myrcene 66.4%; farnesene trace. Humulene/caryophyllene ratio = 2.35

MAJOR TRAITS: Appears to combine moderately high alpha acids content with pleasant aroma characteristics.

OTHER INFORMATION: Was planted on a 4-acre plot in Oregon near Mt. Angel, but had to be discontinued due to severe mildew infection. A 300-acre commercial plot in Washington and 100 acres in Idaho was contracted to Anheuser Busch starting in 1988. Like its half-sister USDA 21222 (Aquila), Banner was officially released by Dr. Romanko in 1996. Brewing evaluation (mainly by Anheuser Busch) of Banner has been inconclusive, and the variety was recently eliminated from further testing.

Humulus lupulus L. var. lupulus

Genus:

Humulus

Family:

Cannabaceae

Nomen number:

415440

Verified:

11/10/1999 by ARS Systematic Botanists.

Other conspecific taxa

Humulus lupulus L. (10 active accession[s])
Humulus lupulus L. var. cordifolius (Miq.) Maxim. (1 active accession[s])
Humulus lupulus L. var. lupuloides E. Small (143 active accession[s])
Humulus lupulus L. var. neomexicanus A. Nelson & Cockerell (96 active accession[s])
Humulus lupulus L. var. pubescens E. Small (10 active accession[s])

Autonyms (not in current use), synonyms and invalid designations

Common names

Language	Name	seq	Citation
English	common hop	1	Erhardt, W. et al. 2008. Der große Zander: Enzyklopädie der Pflanzennamen 1470.
English	European hop	1	Huxley, A., ed. 1992. The new Royal Horticultural Society dictionary of gardening
English	hop	1	Wiersema, J. H. & B. León. 1999. World economic plants: a standard reference CRC Press, Boca Raton, FL.
French	houblon	2	Rehm, S. 1994. Multilingual dictionary of agronomic plants
German	gewöhnlicher Hopfen	2	Erhardt, W. et al. 2008. Der große Zander: Enzyklopädie der Pflanzennamen 1470.
German	Hopfen	2	Rehm, S. 1994. Multilingual dictionary of agronomic plants
Portuguese	lúpulo	2	Rehm, S. 1994. Multilingual dictionary of agronomic plants
Portuguese (Brazil)	lúparo	2	Groth, D. 2005. pers. comm. Note: re. Brazilian common names
Portuguese (Brazil)	vinho-do-norte	2	Groth, D. 2005. pers. comm. Note: re. Brazilian common names
Spanish	lúpulo	2	Rehm, S. 1994. Multilingual dictionary of agronomic plants
Transcribed Chinese	pi jiu hua	2	Wu Zheng-yi & P. H. Raven et al., eds. 1994-. Flora of China (English edition).
Transcribed Korean	hop	2	Mun-Chan, B. et al. 1986. A checklist of the Korean cultivated plants. Kulturpflanze 34:103.

Annotations

Taxonomic Re-Identification: 31 Oct 2010, from Humulus lupulus L. to Humulus lupulus L. var. lupulus

Observations

Phenotype Data

Category	Descriptor	Description	Value	Study	Inventory	Availability
MOLECULAR	HI_AGA7	Motif: (CAT)3N3(CTT)9N3(CTT)3 F: ACAAGCAGTAATGATGAGGA R: TCCAAGTCTCTCAATTAGGAA	181:209	Driskill et al. 2021 unpublished-SSR data	CHUM 611 .002 PL	Not Available
MOLECULAR	K10315842	Motif: (TGG)8 F: CTCAACTACCCTCTCGTCTG R: TAGCTGGAATGAGCGAAGTA	267:270	Driskill et al. 2021 unpublished-SSR data	CHUM 611 .002 PL	Not Available
MOLECULAR	K10315910	Motif: (CTT)7 F: GATAGCCAATCTGGTATGGA R: GGGTAACGAAATCCCTAACT	359:369	Driskill et al. 2021 unpublished-SSR data	CHUM 611 .002 PL	Not Available
MOLECULAR	K10316221 pig	Motif: (TCT)7 F: GTTGTTCTCTTCCAACCAAG Rp: GTTTCCAAAGAAGACCCATTACAG	125:156	Driskill et al. 2021 unpublished-SSR data	CHUM 611 .002 PL	Not Available
MOLECULAR	Hop Primer 1	Motif: (CTT)n F: AACAAGCTCTGGTAATAACAACAT R: AAAACAAGAACCAGAGATAAGGAC	232:253	Driskill et al. 2021 unpublished-SSR data	CHUM 611 .002 PL	Not Available
MOLECULAR	Hop Primer 6	Motif: T/A, GAA/TTC F: AAAGCGAAAACTCATGAAAAGGTT R: GACACATGTAAGGTGACCTTTACA	249	Driskill et al. 2021 unpublished-SSR data	CHUM 611 .002 PL	Not Available
MOLECULAR	K10315931 pig	Motif: (CTT)7 F: TCTCCCTAAATGCTATTGTCA Rp: GTTTCGATCATTAGGGTTGAATC	304:312	Driskill et al. 2021 unpublished-SSR data	CHUM 611 .002 PL	Not Available
MOLECULAR	K10316016	Motif: (AAT)5 F: TACAGGTGCAGTAGCTCAAA R: ATCAAGCTCCTCTAAACCCT	391:397	Driskill et al. 2021 unpublished-SSR data	CHUM 611 .002 PL	Not Available
MOLECULAR	ACA1-K9-3	Motif: (TTC)17 F: ATCCTTCTCTCATTACATACTCAGC R: CCTATGACGGTTCTTATGAGTGC	165:211	Driskill et al. 2021 unpublished-SSR data	CHUM 611 .002 PL	Not Available