Details for: PI 558685, Humulus lupulus L. var. lupulus, 'Landhopfen'

Summary Data

Taxonomy:

Humulus lupulus L. var. lupulus

Cultivar:

'Landhopfen'

Origin:

Developed – Germany

Maintained:

National Clonal Germplasm Repository

Received by NPGS:

25 Mar 1982

Improvement Status:

Cultivar

Reproductive Uniformity:

Hybrid

Form Received:

Plant

Life Form:

Perennial

Life Cycle:

Perennial

Backup Location:

National Laboratory for Genetic Resources Preservation

Availability

This accession is not available. Contact site for status.

National Clonal Germplasm Repository

Due to a recent decrease in resources, we are in the process of restructuring our distribution and are not able to accept requests for this material at this time.

Images (1 total. Click on image for more.)

Core Passport Data

Taxonomy:

Humulus lupulus L. var. lupulus

Cultivar:

'Landhopfen'

Origin:

Developed – Germany

Maintained:

National Clonal Germplasm Repository

Received by NPGS:

25 Mar 1982

Improvement Status:

Cultivar

Reproductive Uniformity:

Hybrid

Form Received:

Plant

Life Form:

Perennial

Life Cycle:

Perennial

Source History

Developed

Germany

Donated

Germany

Donor(s):

Haunold, Alfred, USDA, ARS

05 March 1999.
Oregon, United States
Comment: Replacement for dead plant
Donor(s):

Henning, John A., USDA, ARS, NFSPRC

Accession Names and Identifiers

'Landhopfen'

Type: Cultivar name

Group: HOPS

USDA 21172

Type: Site identifier

Group: OTHERNUM

other identifier

CHUM 205

Type: Site identifier

Group: LOCAL

Corvallis local number

Narrative

No longer grown anywhere in the world

Cultivar Synonym= USDA 21172

Humulus lupulus L. var. lupulus

Genus:

Humulus

Family:

Cannabaceae

Nomen number:

415440

Verified:

11/10/1999 by ARS Systematic Botanists.

Other conspecific taxa

Humulus lupulus L. (10 active accession[s])
Humulus lupulus L. var. cordifolius (Miq.) Maxim. (1 active accession[s])
Humulus lupulus L. var. lupuloides E. Small (143 active accession[s])
Humulus lupulus L. var. neomexicanus A. Nelson & Cockerell (96 active accession[s])
Humulus lupulus L. var. pubescens E. Small (10 active accession[s])

Autonyms (not in current use), synonyms and invalid designations

Common names

Language	Name	seq	Citation
English	common hop	1	Erhardt, W. et al. 2008. Der große Zander: Enzyklopädie der Pflanzennamen 1470.
English	European hop	1	Huxley, A., ed. 1992. The new Royal Horticultural Society dictionary of gardening
English	hop	1	Wiersema, J. H. & B. León. 1999. World economic plants: a standard reference CRC Press, Boca Raton, FL.
French	houblon	2	Rehm, S. 1994. Multilingual dictionary of agronomic plants
German	gewöhnlicher Hopfen	2	Erhardt, W. et al. 2008. Der große Zander: Enzyklopädie der Pflanzennamen 1470.
German	Hopfen	2	Rehm, S. 1994. Multilingual dictionary of agronomic plants
Portuguese	lúpulo	2	Rehm, S. 1994. Multilingual dictionary of agronomic plants
Portuguese (Brazil)	lúparo	2	Groth, D. 2005. pers. comm. Note: re. Brazilian common names
Portuguese (Brazil)	vinho-do-norte	2	Groth, D. 2005. pers. comm. Note: re. Brazilian common names
Spanish	lúpulo	2	Rehm, S. 1994. Multilingual dictionary of agronomic plants
Transcribed Chinese	pi jiu hua	2	Wu Zheng-yi & P. H. Raven et al., eds. 1994-. Flora of China (English edition).
Transcribed Korean	hop	2	Mun-Chan, B. et al. 1986. A checklist of the Korean cultivated plants. Kulturpflanze 34:103.

Annotations

Taxonomic Re-Identification: 30 Oct 2010, from Humulus lupulus L. to Humulus lupulus L. var. lupulus

Observations

Phenotype Data

Category	Descriptor	Description	Value	Study	Inventory	Availability
CHEMICAL	Alpha acids %	Alpha acids %	3.5	A. Haunold 1987 Hop Descriptors	CHUM 205 .002 PL	Not Available
CHEMICAL	Beta acids %	Beta acids %	3.2	A. Haunold 1987 Hop Descriptors	CHUM 205 .002 PL	Not Available
CHEMICAL	Cohumulone %	Cohumulone %	23	A. Haunold 1987 Hop Descriptors	CHUM 205 .002 PL	Not Available
CHEMICAL	Total oil (ml/100g)	Total oil (ml/100g)	0.37	A. Haunold 1987 Hop Descriptors	CHUM 205 .002 PL	Not Available
DISEASE	Downy mildew	Downy mildew	Moderately resistant	A. Haunold 1987 Hop Descriptors	CHUM 205 .002 PL	Not Available
DISEASE	Verticillium wilt	Verticillium wilt	Unknown	A. Haunold 1987 Hop Descriptors	CHUM 205 .002 PL	Not Available
GENSTOCK	HUMULUS CORE SUBSET	A flag to indicate the accession is part of the core subset	Yes	HUMULUS.CORE.1998		Not Available
GROWTH	Vigor	Vigor	Poor to good	A. Haunold 1987 Hop Descriptors	CHUM 205 .002 PL	Not Available
MOLECULAR	HI_AGA7	Motif: (CAT)3N3(CTT)9N3(CTT)3 F: ACAAGCAGTAATGATGAGGA R: TCCAAGTCTCTCAATTAGGAA	178:206	Driskill et al. 2021 unpublished-SSR data	CHUM 205 .002 PL	Not Available
MOLECULAR	K10315842	Motif: (TGG)8 F: CTCAACTACCCTCTCGTCTG R: TAGCTGGAATGAGCGAAGTA	267:285	Driskill et al. 2021 unpublished-SSR data	CHUM 205 .002 PL	Not Available
MOLECULAR	K10315910	Motif: (CTT)7 F: GATAGCCAATCTGGTATGGA R: GGGTAACGAAATCCCTAACT	369	Driskill et al. 2021 unpublished-SSR data	CHUM 205 .002 PL	Not Available
MOLECULAR	K10316221 pig	Motif: (TCT)7 F: GTTGTTCTCTTCCAACCAAG Rp: GTTTCCAAAGAAGACCCATTACAG	140:156	Driskill et al. 2021 unpublished-SSR data	CHUM 205 .002 PL	Not Available
MOLECULAR	Hop Primer 1	Motif: (CTT)n F: AACAAGCTCTGGTAATAACAACAT R: AAAACAAGAACCAGAGATAAGGAC	250:253	Driskill et al. 2021 unpublished-SSR data	CHUM 205 .002 PL	Not Available
MOLECULAR	Hop Primer 6	Motif: T/A, GAA/TTC F: AAAGCGAAAACTCATGAAAAGGTT R: GACACATGTAAGGTGACCTTTACA	249	Driskill et al. 2021 unpublished-SSR data	CHUM 205 .002 PL	Not Available
MOLECULAR	K10315931 pig	Motif: (CTT)7 F: TCTCCCTAAATGCTATTGTCA Rp: GTTTCGATCATTAGGGTTGAATC	309:312	Driskill et al. 2021 unpublished-SSR data	CHUM 205 .002 PL	Not Available
MOLECULAR	K10316016	Motif: (AAT)5 F: TACAGGTGCAGTAGCTCAAA R: ATCAAGCTCCTCTAAACCCT	391:397	Driskill et al. 2021 unpublished-SSR data	CHUM 205 .002 PL	Not Available
MOLECULAR	ACA1-K9-3	Motif: (TTC)17 F: ATCCTTCTCTCATTACATACTCAGC R: CCTATGACGGTTCTTATGAGTGC	174:211	Driskill et al. 2021 unpublished-SSR data	CHUM 205 .002 PL	Not Available
MORPHOLOGY	Leaf Color	Leaf Color	Light green	A. Haunold 1987 Hop Descriptors	CHUM 205 .002 PL	Not Available
PHYSIOLOGY	Sex	Sex	Female	A. Haunold 1987 Hop Descriptors	CHUM 205 .002 PL	Not Available
PHYSIOLOGY	Lateral branch length (inches)	Lateral branch length (inches)	6	A. Haunold 1987 Hop Descriptors	CHUM 205 .002 PL	Not Available
PHYSIOLOGY	Storage stability	Storage stability	Good	A. Haunold 1987 Hop Descriptors	CHUM 205 .002 PL	Not Available
PRODUCTION	Maturity	Maturity	Early	A. Haunold 1987 Hop Descriptors	CHUM 205 .002 PL	Not Available
PRODUCTION	Yield	Yield	1000	A. Haunold 1987 Hop Descriptors	CHUM 205 .002 PL	Not Available