Details for: PI 558670, Humulus lupulus L. var. lupulus, 'Talisman'

Summary Data

Taxonomy:

Humulus lupulus L. var. lupulus

Cultivar:

'Talisman'

Origin:

Developed – Idaho, United States

Maintained:

National Clonal Germplasm Repository

Received by NPGS:

25 Mar 1982

Improvement Status:

Cultivar

Reproductive Uniformity:

Hybrid

Form Received:

Plant

Life Form:

Perennial

Life Cycle:

Perennial

Availability

This accession is not available. Contact site for status.

National Clonal Germplasm Repository

Due to a recent decrease in resources, we are in the process of restructuring our distribution and are not able to accept requests for this material at this time.

There are no images for this accession.

Core Passport Data

Taxonomy:

Humulus lupulus L. var. lupulus

Cultivar:

'Talisman'

Origin:

Developed – Idaho, United States

Maintained:

National Clonal Germplasm Repository

Received by NPGS:

25 Mar 1982

Improvement Status:

Cultivar

Reproductive Uniformity:

Hybrid

Form Received:

Plant

Life Form:

Perennial

Life Cycle:

Perennial

Source History

Developed

Idaho, United States
Comment: Cultivar introduced in 1968
Developer(s):

University of Idaho

Donated

25 March 1982.
Oregon, United States
Comment: Received from Romanko in Idaho to USDA Hops Research Proj. to NCGR-Corvallis.
Donor(s):

Haunold, Alfred, USDA, ARS

Accession Names and Identifiers

'Talisman'

Type: Cultivar name

Group: HOPS

USDA 65101

Type: Other or unclassified name

Group: OTHERNUM

other identifier

CHUM 170

Type: Site identifier

Group: LOCAL

Corvallis local number

PHUM 170

Type: Inventory

Narrative

Acreage grown has declined since 1973

Cultivar Synonym= USDA 65101

NAMED FOR= A magical object worn around the neck for protection

Humulus lupulus L. var. lupulus

Genus:

Humulus

Family:

Cannabaceae

Nomen number:

415440

Verified:

11/10/1999 by ARS Systematic Botanists.

Other conspecific taxa

Humulus lupulus L. (10 active accession[s])
Humulus lupulus L. var. cordifolius (Miq.) Maxim. (1 active accession[s])
Humulus lupulus L. var. lupuloides E. Small (143 active accession[s])
Humulus lupulus L. var. neomexicanus A. Nelson & Cockerell (96 active accession[s])
Humulus lupulus L. var. pubescens E. Small (10 active accession[s])

Autonyms (not in current use), synonyms and invalid designations

Common names

Language	Name	seq	Citation
English	common hop	1	Erhardt, W. et al. 2008. Der große Zander: Enzyklopädie der Pflanzennamen 1470.
English	European hop	1	Huxley, A., ed. 1992. The new Royal Horticultural Society dictionary of gardening
English	hop	1	Wiersema, J. H. & B. León. 1999. World economic plants: a standard reference CRC Press, Boca Raton, FL.
French	houblon	2	Rehm, S. 1994. Multilingual dictionary of agronomic plants
German	gewöhnlicher Hopfen	2	Erhardt, W. et al. 2008. Der große Zander: Enzyklopädie der Pflanzennamen 1470.
German	Hopfen	2	Rehm, S. 1994. Multilingual dictionary of agronomic plants
Portuguese	lúpulo	2	Rehm, S. 1994. Multilingual dictionary of agronomic plants
Portuguese (Brazil)	lúparo	2	Groth, D. 2005. pers. comm. Note: re. Brazilian common names
Portuguese (Brazil)	vinho-do-norte	2	Groth, D. 2005. pers. comm. Note: re. Brazilian common names
Spanish	lúpulo	2	Rehm, S. 1994. Multilingual dictionary of agronomic plants
Transcribed Chinese	pi jiu hua	2	Wu Zheng-yi & P. H. Raven et al., eds. 1994-. Flora of China (English edition).
Transcribed Korean	hop	2	Mun-Chan, B. et al. 1986. A checklist of the Korean cultivated plants. Kulturpflanze 34:103.

Annotations

Taxonomic Re-Identification: 30 Oct 2010, from Humulus lupulus L. to Humulus lupulus L. var. lupulus

Observations

Phenotype Data

Category	Descriptor	Description	Value	Study	Inventory	Availability
MOLECULAR	HI_AGA7	Motif: (CAT)3N3(CTT)9N3(CTT)3 F: ACAAGCAGTAATGATGAGGA R: TCCAAGTCTCTCAATTAGGAA	172:181	Driskill et al. 2021 unpublished-SSR data	CHUM 170 .003 PL	Not Available
MOLECULAR	K10315842	Motif: (TGG)8 F: CTCAACTACCCTCTCGTCTG R: TAGCTGGAATGAGCGAAGTA	267:279	Driskill et al. 2021 unpublished-SSR data	CHUM 170 .003 PL	Not Available
MOLECULAR	K10315910	Motif: (CTT)7 F: GATAGCCAATCTGGTATGGA R: GGGTAACGAAATCCCTAACT	362:369	Driskill et al. 2021 unpublished-SSR data	CHUM 170 .003 PL	Not Available
MOLECULAR	K10316221 pig	Motif: (TCT)7 F: GTTGTTCTCTTCCAACCAAG Rp: GTTTCCAAAGAAGACCCATTACAG	125:156	Driskill et al. 2021 unpublished-SSR data	CHUM 170 .003 PL	Not Available
MOLECULAR	Hop Primer 1	Motif: (CTT)n F: AACAAGCTCTGGTAATAACAACAT R: AAAACAAGAACCAGAGATAAGGAC	226:253	Driskill et al. 2021 unpublished-SSR data	CHUM 170 .003 PL	Not Available
MOLECULAR	Hop Primer 6	Motif: T/A, GAA/TTC F: AAAGCGAAAACTCATGAAAAGGTT R: GACACATGTAAGGTGACCTTTACA	237	Driskill et al. 2021 unpublished-SSR data	CHUM 170 .003 PL	Not Available
MOLECULAR	K10315931 pig	Motif: (CTT)7 F: TCTCCCTAAATGCTATTGTCA Rp: GTTTCGATCATTAGGGTTGAATC	303:312	Driskill et al. 2021 unpublished-SSR data	CHUM 170 .003 PL	Not Available
MOLECULAR	K10316016	Motif: (AAT)5 F: TACAGGTGCAGTAGCTCAAA R: ATCAAGCTCCTCTAAACCCT	397	Driskill et al. 2021 unpublished-SSR data	CHUM 170 .003 PL	Not Available
MOLECULAR	ACA1-K9-3	Motif: (TTC)17 F: ATCCTTCTCTCATTACATACTCAGC R: CCTATGACGGTTCTTATGAGTGC	165:211	Driskill et al. 2021 unpublished-SSR data	CHUM 170 .003 PL	Not Available