Details for: PI 558646, Humulus lupulus L. var. neomexicanus A. Nelson & Cockerell, Colorado 3-1

Summary Data

Taxonomy:

Humulus lupulus L. var. neomexicanus A. Nelson & Cockerell

Top Name:

Colorado 3-1

Origin:

Collected – Colorado, United States

Maintained:

National Clonal Germplasm Repository

Received by NPGS:

25 Mar 1982

Improvement Status:

Breeding material

Reproductive Uniformity:

Population

Form Received:

Plant

Life Form:

Perennial

Life Cycle:

Perennial

Backup Location:

National Laboratory for Genetic Resources Preservation

Availability

This accession is not available. Contact site for status.

National Clonal Germplasm Repository

Due to a recent decrease in resources, we are in the process of restructuring our distribution and are not able to accept requests for this material at this time.

Images (1 total. Click on image for more.)

Core Passport Data

Taxonomy:

Humulus lupulus L. var. neomexicanus A. Nelson & Cockerell

Top Name:

Colorado 3-1

Origin:

Collected – Colorado, United States

Maintained:

National Clonal Germplasm Repository

Received by NPGS:

25 Mar 1982

Improvement Status:

Breeding material

Reproductive Uniformity:

Population

Form Received:

Plant

Life Form:

Perennial

Life Cycle:

Perennial

Source History

Collected

1960.
Colorado, United States
Locality: Near Masonville, CO

Collector(s):

Horner, Chester E.

Developed

Oregon, United States

Developer(s):

USDA/ARS

Donated

25 March 1982.
Oregon, United States
Comment: Collected wild by Horner to USDA Hops Research Project to NCGR-Corvallis
Donor(s):

Haunold, Alfred, USDA, ARS

Accession Names and Identifiers

Colorado 3-1

Type: Site identifier

Group: SPECIES

accession preserved for genes

Horner, Chester E.

USDA 60029 Colorado 3-1

Type: Developer identifier

Group: OTHERNUM

other identifier

CHUM 106

Type: Site identifier

Group: LOCAL

Corvallis local number

Horner, Chester E.

Narrative

Very poor spring regrowth and vigor, susceptible to mildew

Cultivar Synonym= USDA 60029

Humulus lupulus L. var. neomexicanus A. Nelson & Cockerell

Genus:

Humulus

Family:

Cannabaceae

Nomen number:

415435

Place of publication:

Proc. Biol. Soc. Washington 16:45. 1903

Verified:

11/10/1999 by ARS Systematic Botanists.

Other conspecific taxa

Humulus lupulus L. (10 active accession[s])
Humulus lupulus L. var. cordifolius (Miq.) Maxim. (1 active accession[s])
Humulus lupulus L. var. lupuloides E. Small (143 active accession[s])
Humulus lupulus L. var. lupulus (236 active accession[s])
Humulus lupulus L. var. pubescens E. Small (10 active accession[s])

Autonyms (not in current use), synonyms and invalid designations

Common names

Annotations

Taxonomic Re-Identification: 21 Nov 2010, from Humulus lupulus L. to Humulus lupulus L. var. neomexicanus A. Nelson & Cockerell

Observations

Phenotype Data

Category	Descriptor	Description	Value	Study	Inventory	Availability
CHEMICAL	Alpha acids %	Alpha acids %	5	A. Haunold 1987 Hop Descriptors	CHUM 106 .003 PL	Not Available
CHEMICAL	Beta acids %	Beta acids %	3	A. Haunold 1987 Hop Descriptors	CHUM 106 .003 PL	Not Available
CHEMICAL	Total oil (ml/100g)	Total oil (ml/100g)	1.2	A. Haunold 1987 Hop Descriptors	CHUM 106 .003 PL	Not Available
DISEASE	Downy mildew	Downy mildew	Susceptible	A. Haunold 1987 Hop Descriptors	CHUM 106 .003 PL	Not Available
DISEASE	Verticillium wilt	Verticillium wilt	Unknown	A. Haunold 1987 Hop Descriptors	CHUM 106 .003 PL	Not Available
GROWTH	Vigor	Vigor	Poor	A. Haunold 1987 Hop Descriptors	CHUM 106 .003 PL	Not Available
MOLECULAR	HI_AGA7	Motif: (CAT)3N3(CTT)9N3(CTT)3 F: ACAAGCAGTAATGATGAGGA R: TCCAAGTCTCTCAATTAGGAA	172:181	Driskill et al. 2021 unpublished-SSR data	CHUM 106 .003 PL	Not Available
MOLECULAR	K10315842	Motif: (TGG)8 F: CTCAACTACCCTCTCGTCTG R: TAGCTGGAATGAGCGAAGTA	267:279	Driskill et al. 2021 unpublished-SSR data	CHUM 106 .003 PL	Not Available
MOLECULAR	K10315910	Motif: (CTT)7 F: GATAGCCAATCTGGTATGGA R: GGGTAACGAAATCCCTAACT	359:369	Driskill et al. 2021 unpublished-SSR data	CHUM 106 .003 PL	Not Available
MOLECULAR	K10316221 pig	Motif: (TCT)7 F: GTTGTTCTCTTCCAACCAAG Rp: GTTTCCAAAGAAGACCCATTACAG	125:156	Driskill et al. 2021 unpublished-SSR data	CHUM 106 .003 PL	Not Available
MOLECULAR	Hop Primer 1	Motif: (CTT)n F: AACAAGCTCTGGTAATAACAACAT R: AAAACAAGAACCAGAGATAAGGAC	226:253	Driskill et al. 2021 unpublished-SSR data	CHUM 106 .003 PL	Not Available
MOLECULAR	Hop Primer 6	Motif: T/A, GAA/TTC F: AAAGCGAAAACTCATGAAAAGGTT R: GACACATGTAAGGTGACCTTTACA	228:237	Driskill et al. 2021 unpublished-SSR data	CHUM 106 .003 PL	Not Available
MOLECULAR	K10315931 pig	Motif: (CTT)7 F: TCTCCCTAAATGCTATTGTCA Rp: GTTTCGATCATTAGGGTTGAATC	303:312	Driskill et al. 2021 unpublished-SSR data	CHUM 106 .003 PL	Not Available
MOLECULAR	K10316016	Motif: (AAT)5 F: TACAGGTGCAGTAGCTCAAA R: ATCAAGCTCCTCTAAACCCT	397	Driskill et al. 2021 unpublished-SSR data	CHUM 106 .003 PL	Not Available
MOLECULAR	ACA1-K9-3	Motif: (TTC)17 F: ATCCTTCTCTCATTACATACTCAGC R: CCTATGACGGTTCTTATGAGTGC	165:211	Driskill et al. 2021 unpublished-SSR data	CHUM 106 .003 PL	Not Available
MORPHOLOGY	Leaf Color	Leaf Color	Medium green	A. Haunold 1987 Hop Descriptors	CHUM 106 .003 PL	Not Available
PHYSIOLOGY	Sex	Sex	Female	A. Haunold 1987 Hop Descriptors	CHUM 106 .003 PL	Not Available
PHYSIOLOGY	Lateral branch length (inches)	Lateral branch length (inches)	6	A. Haunold 1987 Hop Descriptors	CHUM 106 .003 PL	Not Available
PHYSIOLOGY	Storage stability	Storage stability	Unknown	A. Haunold 1987 Hop Descriptors	CHUM 106 .003 PL	Not Available
PRODUCTION	Maturity	Maturity	Early to medium early	A. Haunold 1987 Hop Descriptors	CHUM 106 .003 PL	Not Available
PRODUCTION	Yield	Yield	Poor	A. Haunold 1987 Hop Descriptors	CHUM 106 .003 PL	Not Available